Description :
From Genome Similarity Track
Location :
Scaffold_1065:1422- 10721
Transcript NameFunction/comments
Pytiw_DAOMBR242034maker-piw_contig_1065-fgenesh-gene-0.0U4/U6.U5 tri-snRNP-associated protein
Pytiw_DAOMBR242034maker-piw_contig_1065-snap-gene-0.11Spastin and Fidgetin
Pytiw_DAOMBR242034maker-piw_contig_1065-fgenesh-gene-0.1Elongation factor P
Pytiw_DAOMBR242034maker-piw_contig_1065-fgenesh-gene-0.2Conserved gene of unknown function
Pytiw_DAOMBR242034maker-piw_contig_1065-snap-gene-0.10Conserved gene of unknown function
Pytiw_DAOMBR242034fgenesh_masked-piw_contig_1065-abinit-gene-0.23Protein phosphatase 2C 11

Sequence
9299 bases(100 bases per row)
GCGCAAGATGTGGAGTCCACACAACTTCAAGAACACGGTATTTGTCTAATTTTCATTCGATATGTCGCGGGTATATTTTTTAGCTGGCTCTGATCACAGC
TAATTATTGTGTATGCGATTGGTTTTTTTTAACAGATTAGTCCGCACGAGTTTGTGCAGGAAGTGTCGGTGAGCAGCAAGAAGCGCTTCCATGTGGGCCA
ACAGAACGAGAGTGTCGAGTTCCTCTCGTGGCTGCTCAATGAGCTGCATCGCGTACGTTCCCAATCATGTGGGTCTGTAAACAACCGTGAGGTTTGCATC
CTCACACTCATATAATTCCTTTATACCATTTTTGTTTCGAAGGGTCTCGGCGGATCGTCCAAGCCTGGCAGCAGCATCATCCACAAGTGCTTCCAGGGGT
TTATTCAGGTGACCACCGTCGATGAGAGCAAGACTGCGAATCCAGCCGAGGACAGCAACCAGACCACGAGCGCCAAGTCACCCTTCTTGCTGATGTCACT
GGATTTGCCATCGGCGCCGCTTTTCAAGGACTCACAGGGTGGGAACATCATCCCTCAGGTTCGTTTTCTTATTCTAATTGCTGATTAAGCTTTGTGATTT
TCAAATGACTGACCAAATTGATGCGCTATTCATCTACTGTGTTTATGCAGGTGCCTCTCTTCACGGTGCTGGAAAAATACGACGGCACGCACGTCACGGT
GAGCCAGCTGTATACTCTTGTGCACAACTTAGTTTATTTTCTCACGAACTATATTGTTGTGAAAAATAATATTGCAGCATATCCTCCAAGGCTCGCAGCG
GCTGAAGAAGACGTACAAGATCGAGTCGCTGCCTCCGTACATTATTTTCCACGTCAAGCGCTTCACGCGCAACAATTTTTTCACGGAGAAGAACCCGACG
ATCGTGAATTTTCCTGTGAAGAACCTCGAACTGCGCGAGTATCTGAACTTGGACGGGTCGATGCCAACAGAAGAAGAGCTGGCGAATATGTACGTTCTCT
GTTTGCTTTGCTGGGAGTTGCTAACCGCTGGTTATGCTGACTGAATTCGAATTTGGCGTGCTTTACAGGTCGATTTCGGAATTACGCGCCATCTTGACCA
AGCACAAAGTGTCATCAAAGGTACGAGATGTTTGTCGCTTAACTATCTATCTAAATTATCTACAGCCACTTACATGACTGCGGCTGGTTGTATACTTAGG
ACTGTCTCGAAAAGGCTGATTTGGTGAGCAAGGTGCTCCAGGTGACGATTCCGTCAACCAAGTAAGTGCTGTTTGTTGCTTTGCATCGCGACCAACGCTA
TCGAGCAAGTGAAACTAAACATCTGCTATGGTTTGTGATTGGCAGGTACAACTTGATCTCCAACATTGTCCACGACAGTCCCGTGACCACAGGACGAGAG
GCAGCTTTGAAGACGAACCCACTGACCGAAGGGAGCTACCGCGTGCACGTGCAGAACAGAGTAAGTCGCTGAGGTCTTGCAGTGTTGCTTTGGACAACTG
GAGTGATTTTAAATCTCACTGACCAAACACATTGTGTTGATTTGTTAAAGGCGACCGAGCAGTGGTACGAGATCCAAGACCTCCACGTACAGGAGACGAT
GCCCCAGCTCATTGGCGTCTCTGAGTCGTACATGATGGTCTACGAGCGAAAAGAATGAGCGAGGCGCCCAAGGTCGCGAAGCTCACTTTCGCAACCAAAG
CTAGAACAAACCGCAACATAAGAGGTGGACAACAGGAACGAGGTGACTCAAATACATACCTGCCGTGCTGTCCCCAATGCATCCTTATATGTGATTATAA
TTCACTCAAGCGACGAGAATGTTACTTGCCAGTAGCCGAGATGCCATACAAGTCGTTCCACGCAAGCAGCGCTTTGACAGTCTCGCTCGAGACGCTTGGC
CGCACGCGTGCAAGCGCTGTCGCAAAATCTTCGAAGTTGATCCCGCGCACGTCCTCGCTCTTCACCTGCGTGATGCGCGCGCCGAGCTCTCGGATCGGTC
CCATCGCTGCGTCTTTGCACAGCGCCTTGAGGTCGCTGCCAGAGTACCCGTCGGTGGATTTCACAATCTTCGCCATGTCTCGAGCAGCGATCGAGGTCTT
TTGGGTATCCAGGAGATGGCGAAGCAGGGTTTGTCTCGACTCTTCGTCGGGAAGAGGCACTGAAACAAGAGCGGAAGCGAGCAAAACCATGAGTTCACAA
AGTCACAGGAGCAGCAGAGTCCAGTCGATCTGACAAAAAGACGACATACCATAAATCCGTTTCTCGAGACGCCGAATGATCGCTTCGTCCAGCTCTTGCG
GCAAATTGGTCGCCCCCATGACGAGGATTCTGTCATTTGGCGATGATGCAGCGCCATCGAGCTCCATGAAGAACTGAATATGGGTAACAACAGGCTGTCA
GATTAATCACACAAGGTCACAGACTCGGTTGAATGTTGAAAGTCAACTGGTAAACCTGGTTCTTAAGCCGCCTGCTCGCGTCGTTCTCGGACGCCGACCG
TGTGGACAGCAGCGCGTCCATTTCGTCGAGAAAGATCACCGCTGGCTGCAACTCGCGCGCGATCTCAAAGAGCGTGCGCACCAGTTTCTCGCCCTCGCCG
ACCCATTTCGACGTCAGCGTCGATGCGGATATGCTGTGTTCATAGTAGGATCAAACGACAACAAGTTGAGTACCAGAGATGAAAAAACGCACCGAGAGCC
TAACAACAGTGACCACACACTTGAAGAAAGTCGCGTTCGACTCGGTCGCCACAGCTTTTGCAAGTAGAGTCTTCCCTGTTATATTACATGATGGCGTGAG
AATTAAATAAACAGAATAAAAAAACAGAATAATACTCTTCACAATACAACACCTGTTCCAGGAGGTCCAAATAGCAGCACACCACGTGGTGGTGCGAGCA
GCCCCGTAAAGAGGTCTGGGCGGAGACTCGGGTAGATCACAGCTTCCTGCGAACAAAATCGAGCTGCGTAACGCCATGCACTCTGAAATACTGCAACGGG
GACTCATGTGTATGGTCGCGTACCTGTAGGATTTGCTTCGCGACGTGCAGCCCAGCGATGTCGTCCCATTTCACCTGTGGTGATCGGTCCAGCACCTCGT
CCAAGATCGTGTGCGCGTGCTGTGTGTTGTGCTGGATGAAGGCAGAGCGGGTCGTGTCCTTATTTTGCGCTATTGTCTGCATGTATGAAGGGCTTAAGGG
TCAGCCCACGGCTTTACATGTAAGTACAACGCAAGCCTTCTTGTATACGTACCGGTCCAATGGCTCCGTTCGGCGGATGACTCTGAGCAGCTACTGCGTG
CTGCTGCTGGTCGATCTGCGCCTTCAGGTACTCGGCGCGCGTCATGTATTCGTGGATCTTGCGGCGCAGCTGCTTTTGCTCGTCCTCATGTGTCGATTCT
GCATTGATACACACGTCAATAGAGCAGTGACAGGTGCGCAACCCAGTTCGTAGCTGCTCATTTTTTTTCTTCTCACGTACGTACGCTGCAGTTTGAGCAT
CATTTTCTCGATGCCTGCCGCGTAGAGGTCCACTGCGAGTGCGTAGTCGCCCTGTGTGTCCGCACGCACTGCGGCCTGGACGCTCGTGGCGATCGCGTCG
TCTGCTTTGTCCCGCGCGGCCCACGCCAGCAAGCGCTGCATCTCTCGTGCTCGTTGTCAAATTATCAGTGACGAAAAAGTGAGCATCATATCTTAGGTGC
TTATTTTTAGCCAATAGATAGATTGTTCTATCAATTTAGACCAATGATAGAGCTTATAGAGGTGACAGGCTTTTCCATCCGTCAATTTGCATTTTGAACC
ACACACAGGCAAGATGCTGCGACGAGTTGCCGGACAGATCGCGCGCGCCGGCGTGGCGAGCGCGCAGCCGTTCGGCGTGGGCGTGCGCTTCGTGAGCATC
AACGGTGGGTCTTGTTTCTCTCTTGTGCTGTGCTTCAATGCGCTGATTGGACGTCCAATATCAATTGAAGAAGCGCAACGTACTGATTGAGCTGTTCATT
TTGCGTGAGCCAGGCAACCAGATCCGCGTGGGCATGGCGCTGGACATTGAAGGACGCATCTACCGCGTCACGAAGAACCAGCCTGTCAAGCCTGGCAAGG
GCGGTGCGTATGCACAGGTGAGTTAGTGTCGTAGAGTTACGATTGAGCTCATCACAGCGAGCAGCTACACTCATGTCATTGTTCATTATGGTTGACGCAT
AACATCTACGCCTGTGGTGCTGTCTTGTATGAAAAGGTCGAGATGAAGGAAATTAAGACGGGCAACAAGACGAATCGTCGCTTCCGCGCAGCCGAGAGCG
TGCAGAAGGCGCCGCTCGGACCGGACCAGTTCTTCCAGTTCCTCTACCAGGACGGTGAGAAGCTCGTGCTCATGCACAACACGACGTTCGAGCAGGTACG
ATATATGATACCATTGAGCTCGTACTAACTTCGTTTGCTTCAGTCAGACTGGGTTTCTAACGAGAGATACACTGACTGTTCGTGTAGATGGAGGTCCCAA
CGGACCTTTTCTCGGAGCGCCAGATGGATTTCTTGCTCGAGGGCATGACGCTCACGCTGCAGATCGTCGACGGCGATGTGCTCTGGGCCAACATGCCCGA
GAGCGTCACGCTCACTGTCACGGTGCGTCGCTCTTGCAACGTATATCTCTTATTTGTTTTGTCACAGGCATTTTTTAACTGGCAACTATCGTGATTGTGG
ATTTATTTGATTTAGAAAACCACGGCCAAGGGCGTGGCGGACACGGCGCTGAGCGTCAAGGACGCGACGCTCGAGAACGGCGCGGTGGTCAAAGTGCCGC
TCTTCATCGAAGTGGGCAACCAGGTGCGCGTGGCCACCGAGGACGGTGCCTACGTCGAGAAGCTCGTGGTCTTCTCGGGCTAAACCTCTGCAAGTTCAAC
TTGACAGATGAAAGGCAAGCCAGTGGATAGACTTGGATTTGAACTGATCTATTCAGTGGTGATCTGTTACACAACAGGAATCAAAGATCTTTTTTTTCTT
TTCTCATCAGGTGATGTCAAGGGTCTCAGCTTCTGAGGATCAATTTCAGGAATACGATGTCGCAGCAACCAGGACATCTGGTTGGAGTAACCCTCCAGAA
TCTGGGTTTACAACAGTCTAAAGATCGTCTTCACCCATTTTCAGCCAATCAGACACGTCAGAAAGTGGAAAAGATACCCTTTTAGACCAATGAAACGCTG
CGAAAAAAACAGCAACATGCATCTAAGTGGGTTGATTGCGAAAGCAATGGCGATCAGACGTGCAGCAGGACGACACACAGGACTGCAGACCAGACGGGGC
CTCTCTCGCGTCCTCTGTCTGCTGAGGCTCCCAGCATACCACAGGTCGACGTCACTTGCGAACTTCCACTCGTGCGCGCTCCTCCTCTTCCTCTCGCGCC
GTCCTTCATCGTAGCTGCTCGTCAACCAAGAGCTCCATCATGGCCCAATCGACCCCAGCCCAAGCCGCGTCTGCCACGTCCACCAGCAGCTACCAAAGCG
GCAGCGCGTCGCCCAAGACTGTCGCGACCACGATCTTGAAACGTCACGTCGACCAGCGCCAGCGCTTCGACTCGGCCGACTATGCGCTGATCCAGAACGC
CGCCGCGACAGCACATACAGAGCGGAGACGCGCTACGAACAGCAATGGCGTGACGCTAGACGAGCAGGAGCCTGAGCCGGAAGCGATGAAGACAGAGGAC
ACGGTGCCGCCGTCGCCGTCCAGGTTAGCGATCGACACGCTCGCGATCACGAGGAGCGCGACGACCGGCAGCGCGTATCCGCAGCAGCACGTGCGGCGCA
TCCGTCTGCAGCGCTTCGACTCGGCCGACTGGGCCATGGACGCCGTCGCAGCGTCCAATGCCGCGCGCTTGTCGTCATGGCCGTCGATAGCGACAGCGAC
GACGCAATCGGCGGTCGCAAAGCTCTTCCTCGACCGCCACGCGTACACGACGTGCCATTTCGTGACGACGCCCGTGGACAAGCGCCAGCGCTGCGCCGAG
AAAGCGTGATCGAGAGCGCGTAGATGGTGTGCATGGGAGTACGCATACGAGACAAGTTTTAGAGTAACAAGTACAGTATCGATATGAATTGAATTAATTG
GACAAAGTCATTTGAGTTCATTATACAGGAATGCAGTCTTGACTAAGTACGAATACTCATGCAGACCGATTTTCAGGAGCTCTTCATTATGCAGCATGAT
CTCCTCGGGGCTGAAGAAGCATGCGCTCGGTGCGTCACTCGCTCTCAGCACAGAGGAAAGGCAGCTTACGTACTGACCTCACGGTGTTGTCGTTGTTTAC
TATGCGTGCGTTGCAGTGGTGCTCATTGCGGTGCTCGTAGCGACGTACCAGATGTTTCGCCTCGAGTCGCAGCGCACGCGGCGCGGCGTTGAAGTGGACG
AAGAGGTTTGCGCTTGTGTATGACACTCAGAAGGCGTCCAGCGTGTTGCTAAGGTGCTATGTACTGATGTGTACCGCGTGTATGCAGTTTGAGCGTGCGA
CGCGATTCCTTCAGAGCCAGCTGGCCTCTCACAACGGCGGCAAGTTCGAAGTGCGCGTCACGCTGTCCATGCACGGGAAGCAGAAGAGCGCGCTCGTGAT
CAATCGACAGCACGCTGTGCCGCGCATCGGTGGGCATTGCACAGTAATAAAAAACTACACATGCGTTATTTAGAGGCTCGCTGATTGATGTGCTGCTCTT
GTGCCCTGATACTGCAGAAGCGGAGCTCTTCGTGGACCCGCATCTCGTGACGAAGCGCAAACAGCACAAGAAGAGCAGTTCAAAGCCCCGCCACGTGTTT
TCGAAAGCAGCGGCAGGTGCGAGTGAGCATTTCCAGCCCACGCTGCGTCTGCGGGTCTATGACCACGCGACTATGGACGCAGTCACCAAGGTGCATGACT
GGCTGGCTTGTGCTTTGCTAGGCGTATTGTACTGCTAACACTGATTCGGTCGTGGTATACAAACTCAGGTATTACAACAGAAAAAGATGATCGAGCCGAA
CGAGCCCAGTCACTAGTCACACTCACAGACGCAGCTAATAGATACAAGTGGGACTTACAGGTTGAACATGTCGATCTCGTCCTCCTCGTCATCATCCTCC
TCCTGGTTCTCGGTCGTCTCTCCGGCAGCAGCCGCGCTGGCGTCGCTGTCCAGCATGCTCGTCATTCGTGGACGCATGAGCCCAGACTGGCGCTGTAGAA
AGCGCGGTGAGGGCTTGTGCTGCGCTGTGCTAATGTCATTGGTGTTGCTGGCCTGCGCCTGTTTGAGATGCGATGAGCCATCCTGCCAGCCGAATTGGAT
CACAGTCGCTGTGAGGTTGTCGCTGCTGCCGCGTCTGTAGGCCTCCTTGACGATCGCGTCGGCGGCTTTCTTGGCGTCTGCAAAGTGGGTCAGCCCTATA
TTCACGGCGTCCTGGTTGCTCATAACGTCCCAGATGCCGTCACACGCGACCACGAGGAACAGATCCTCTCGCTCCACAGTGAAGCGCTTGACCACGGGCT
CGCACGACACGAGCGCAGTCGGCACTTTGAGCGGCCGGTCCCCAAACGCGCGCGAGACGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGTACGTCGCGGACTCAGGCTGCACCGAGAGCCCGGCGCCCGTGGCCGAGTAGACG
CGCGCGATGCCTGCAAATGTGCCGACAAAGCCTCCGGCGCTAAGAATGCGGTGTTTCTCGTCGGGTCGACTGGGCTTGTGGTCCGTGGTGAGCGGCACTC
CCTGGCCGCCGCGACAGAGCACGGCGCGGCAGTCGCCCAGGTTGATCGTGTAGTACGCCAGCTCAGGCAACGGGCTGACACTGGTGGTAGTAGTAGTAGT
GCAGCTACTAATGAACCACACCAGGAGCGCAGTCGAGCCGTCTCGCGACGGATTCTTCTGCACGACCTGCGCGTCGGTCCGCTGGAAACTCTCGCTGAAC
GCGCGCTTGAAGTGTGGATCCTGTGTATGTACCCACGTGCGGAACTGCTCGCGTCGCTCGTCCTCTTCATTATCGATCTGTTTGATGGCGTCCTGCATGG
CATCCACGGCACTGGTCAGTTGGTCATGGAGTGCTTGCACGTCGCTGTCTTCACCCTCAGCCTTGTCTGGTGTTGCTGTGACGCCATCGTCGCCGCCCAG
CATCTGCTGCACCTGCGTGAGCTGCTCCTGGAAAAGCTGCAGCTGGGTCTCAATCTCGCACCGCCGCTGTGCCTCTTTACCCGACTCTTGCTGCAGTGCT
GCGAGCGTGTCCGCATCTCTCGCGTGGACGTGCTGCTTGAGGCTCGAGCTCATGTTCTTGAGCAGGTGCCGCACGAGAAACTCGACCGTGAACACGCCGC
CGTGACCGTCAAAGACGCCAAAAACGGGGCCCGGGAAGCGTGTCGCGTCGGTCACGTGCCGGTCCTCGTTGCTGGGCTTCATGCCCTGCCAGCTCTCGGT
CGCGAAGCGCAACTGTGGGATTGCAAAGCTTTCGATGGTTGGGTTGTGTAGTGCTGCTTTAGAGCCATTGAGCTGCTCTTTCAGCTGGTTGCGCGGCTGA
TCTGCAGCGTCGCTGGTCGTAAAGGCGCTTATGCCGTTGCTGTCGCTTTGGACACGATGGTGTTGGCAGCGCTCGTGCACCGCAGCGTCATCGTCGTCAG
CGCGCAGCTTGCGCTTGAGCTCCTGCGGCATACTCCTCGTCTTCAAAGTGGCTTTCCACGAAATATTTTGCCTTCCAAAGTCCTTTTTATCGAGCTCTCA
CTGTCAATGAGACCCGATAAAAATAACCTGGAGGTAGTGAGTCACTGCACTCGATCCGGAGTATCCCTGCAGCGAAAGTCGCGATGCCCCCAAGACCTGT
GCCCCTTTGGATATCGCAGTTTCAACAGCGCATCAGGGCCAAGCATTAAGCTTCAAGGGATACAACGTCAAATTCGGCCAAAACTTCAGCTTCGAGCTCA
ATGTTGGCAAGCTCTCCGCATCCAGTTGCTACTAGCATTCAGAATCCAACACCTGAATACTCCTTCATCCCAGCAGCTGAAGCTCAAACAACTTCAGTAG
TTGTGGCCCCAACATTGGCGGCGATTCCAGCATCGGTGATCCCAGCATCTCCAGCAACGGCGGTCCCAGGAATGGGCAATGTGTGTGGAAGTCCTGATC