Description :
From Genome Similarity Track
Location :
Scaffold_423:1422- 2765
Transcript NameFunction/comments
Phyag_g5583carbohydrate esterase, putative
Phyag_g5584FAD synthetase, putative

Sequence
1343 bases(100 bases per row)
acgacgatgacgacagtgaagaagaagagaaagtgTCGGAGCCTCCTTCAAAGAAGAAGTGCTCTCAATAAGAGCGTGCTGCGACGGACATCTCGACGGT
CCCTACTCGTGCCCAGCAACTACAAAGACATCACCAACCAAGGACCAAGAACGTGCCGTGGCCGTCGAAACTATCGCAGAAGAAACAATATCAAGCCCTC
CGAGCTCCTTTTCGCCACGGAAACATTGCAGCGTTCGCTTAAaatgctccagctgctggtaTTGACGGTTGATCTCGTGAAAACCCACAACACCACGTTG
ACATGTAAACAGATCGCAATCGAGGCAAGAGAAGCATGAAGCTTTGCTTTACCAGCATTTTTCAGATTTTCACACGTCACATATATCTTCTCGATTTTCA
GCTGTTCACCGGCTCTTTCCATTGGCTATTGCAACCTCAATTTCTTATTCGCCAAAAATATTCTGAATCTGAGCCCACGTCAGCAGTTTACGCACTCACC
AATTTGCCCCATcggaagaagcagcgacCTCGTGTACGTAGCCCAACCTGCGACCCCAGCTTATTCCAGACCACGACATTCTTCTCACCGTGTTAGCAAT
CTCCTGATGCCTCTTCCAAAACCTTATCTGCCAAGTAGCTCCCTGAAAAGCCTCAGTAAATCGACCAAGTTCGACACTTCTCCGCAGACCGCACTTCCTA
CCCATTTCAAGCCTCTAAACCATGACCAGCAACTACAGTATGAGGTCCACGCTACTCCACTTCGACCTGTTCTTCGCTGGGGCTGATCCGGCCATGCAGA
AGCGACTGCAGAAAGCGCTGGACGTGATGCGCAGTGCCATTGACATTTTTGGCTTGGAAAGCGTTTGCTTCAGTTTCAACGGGGGAAAAGACTCGACAGt
ggtgctgcatttgctgcgcATTGTAGTGGCGAAacgcgtgctggaggaggcgcagcTGACGCACCTGAAGGCCGAGCAGGAAGCCCAGGACGGACCCAAG
ACGACTATTACATCGCCACAAAACAGTTTCGTCTCAGTGGActtgctgcaagaagaggagctggaaacGCGTGTCAAGGAGCAATTGCAACGTGTCCCAG
TCATGTATTTCGATTCGTACGATCAGTTCCAAGAGGTGCGGGACTTTAcggacgactgcaacaagaaATACGCGCTCAATTGTCACGTGTACAAGTGTTC
ATTCGTGGAAGGAGTGAAGGATATtttggagaagctcaagatcaaggGCGTGTACATGGGTGTGCGAGGTGGAGACCCGTACACAGAAGACATGGAGCAC
TTCTCCCCGAGCAGTCCAGGATGGCCGCCCTTCCTGCGTGTGA