Description :
From Genome Similarity Track
Location :
Scaffold_103:142166- 151557
Transcript NameFunction/comments
g13109.t1XP_009515602.1 hypothetical protein PHYSODRAFT_473768 [Phytophthora sojae

Sequence
9391 bases(100 bases per row)
AGCATGGCCACGCCACGTGCAACCCAGTGGGCCTCTGGTCTGCTGGTGGGCAGCCGAATGAAGCAGATGAAATTCGTCGAGTGGCCGGTAGTCGACAGCG
TACCTCGTCGCTCGCTGCAATCAAGTTAAATACCAAAGTTAGGATATCTCTGTTGCAGGCGACCAAATTGACACAACCGACCTGGTCTTATATACTGGGC
ACGAGTACGAGCTGCGTTGACTCATGTCGGTCTTCTTCACGGGGTTGAAAAGCAGCACAGGCGCCAAGGAGAACAGCACCTTCGGGTCTGACTCCGCCAG
CTCACTCGTCGCCTTGTCCCATTTGGCGCCTTCGAGGAACATCCCTCGAACGTACACTCCATCCTGATCATAAAAGTTTGTAAGCTTTTCTTACCTATTC
AACAAAACCTGCTACGGGTGGCCGTACCTTTGGTGGCTGCGCGTAGTCGTTCCGCGGCATGGGCTCGTGGTCGAAGCCCAGTTGGTCAATGGGCAAAGTG
TACTTTCGCGCGTAGTTTTGACTGGCACCCGTCAAGAACGCTTGCGTGAAGAAGAAACCCGAGATCCAGAAGACAACTGGCGGCTTCTCTAGCAGCCACT
TGTTGAAGAAGGCAATGCGCTCCAGCAGGTCAGTCACGTAGCTTCCCAACGGCTTCAGGGAAGGGTACGACTTGGACGCCCAGAGTGCTGGGATCTTGCC
GTAGAATAAACTCTTCGAAACATTTTCGAGCTCTGCCGACATGACCACGAGGCCCTTGAGTGCCTTTTGCAGGCTTTCGAGACTCGATCGGATTGTGGAC
ATGAGGTTGTTAAAGCGAACGAGTTCTTGACAGAGCACCGTGTTCATCGACTCGTCCCAACGCACCGGGTAGCGGATCTGTGCCACCTCCATGTCAAAGT
TTGGCGGTAAACGCTGCAGAATGTCGTTGGCCACGGCCTCCACGAGCTCTTCTTGTGACCCGCTGCTACCTTCATTACCGCCCCCTGAGCTCTGTGTAAG
TAGCACGTCGCGACATAGCTTGGCCGTTGCGTTCTGATCTTTGGTGATCGTGGCGTTATCATGGAGCCCAAACACTCCAGGAGGAGCCGCTAAAGGCAAA
CCTTCGATGAACTTGAGGTACGAATCGTAGTCGCCATCGGGTGGCATTGTGTACATACCTTGTTCATCGAAGGCGTAGCCCTCTTTGAAAACATCCAAAC
AGTAAAACTTGCCCAGAACAGACATGAGCGTACGGCGATCTTTGTCGTCTGTCACACGTCCACCGTAGTTACACTCACCGGTGCAATAACGCAATGCGCG
TAAGGGTAACTGCACGTTTTCATCGACGAACATGGCCAATTGGCGAATACTGATGCTCAGGTCAGACTCGTTGAATTCGTACTGAATATTCCAACCAAGA
GGGCCAAATTGCCGACGCTCGCGCACCAAGGCGTGGAAAAAGCACAGCGAGTAAAGAAGCACGCGGAACTCGGGGCCTTTGACCACGGATTCAAGGAAAC
CCTTCTCACCTACCGGGTCCGACATGTAAGAACCCATGAGATTAGCTCGTAATCCTTGCGGTGGTTCATTTGTCATCTTGACACCATTTTGCAGGACGGC
CGCTGGGAACACGTCCGACGGGTACGTTGTGCACCACAGCCGGAAATCTGGGTGCGTATTGTCTAGTTTAATATCTTCAGCAATCTTTTCCATCACAGGC
ATCCAGCTTGGCGCTAAATGGCAATTCTGTAGTACAACCCATGAGCCGGCCTCGCGAGCGCGTACAATCATGCGCTCAGCGATAGGACCTTGACCTTGGC
CCAGTGAAATCGTCTCCGCCTTTTGCCGAAGTGAGTCCGCAAATTTGAGCACGGAGCTGATCGGGTCTGATCCCGGCGACAAGATGAACACTAATGGCGA
TGAAACGCTGCTGTCCGAGTACGAAAGAGCCAAGTCGAACTGCGGGGGCTTCACGAATTTTTCACCCATTTCCTTGACGAGGAACTGTTGGATTCCAACG
ACTAACAGGTCGGGACGGATGCATCGTAGACTTAGGAGTCGACGGAACTCGCTTACTCGCCCCAGTGTCGCAGGGAACGGCAGTGTGTGGCCAACTGGAC
TATCGTAGACCGCCTTCCACTGGTCGTCATGGTCTATGAACTCCTCGATGATGCCATCGAATGCTGGTAGCGCACTTAACCTCGAAAATTCCGCCCACTG
CTTGTCGCTGAGCCACAACTTAGCAGGGTTTGGTGGCGGCTCGGAGAGTGCGATACCTCCAGTGAGCAAGAAGTACCACTCGCTGCTTTCGATCTCGTGT
TTGCCTTGTTTAATAGAAATGCATAGCAGAAAAGAAAACATGAGTTTGTCCTTCTCCAGCAAAGAACGGCAAATGTTGCGGTACAGCGAGTAAGTGAAGT
GGGCATCCAGATTCTGAAGTCGCTGGGTCAGATCCGGTGATCGATCACTGTTCAGGATACTAGCGATGAAGAGATTGATGAACCACGATAGAGAGTACTG
GTAGACGGGCTCAATGTTTGCAAGCTGATCGATGCAGAAGAAGAGCACTTGGCTTGAATAAGCCACCGGTTTGTATCCCTGTCGAACTGAGTCGATCTCC
AGCTCTGTCTTCTCAGCAACTTGCTGCTCCTTTTTGATCTCATCGGCGACTTGCTTACTCTGGTTCATGGTGTTGATAGCGTCTTCATCTTCGAGGATGT
TACCCTGTGACGAAGATAAAATGTTCAGAATCTTGTCTTCGATTTCCTTGAGCAACCCCTTGTTGCGTGCGTTCTGCACAATCAACTTGTTCTTTTGCTC
TTCTAGATCAGGTCTTTCCTGCGCCACAACGATTCCCAAGAGCTGGTCTTCAAGACCGTGAGGCGTGATCATAAAGTTCAAAAGCGTCACCTTCACTGAT
ACCTCTGGCAAATAGTGCGGGTTCCGATACTTGGTCGTAATGTAGAAACGAAAGCTTTCTGCATATTCAACGGTTGAGTCACCGAGACGAATACATGTCA
CCCCACCCTGTTTGAACGTTTGTTTTAGTAAAAGTGGCTCCAGTGACGGGTCCAGTTCCTCTGCAACGTTTTCAAGCAGCACGGGTGTGCCAAACTGTAC
TGAGTTCTCTAGAGTTCGCATATAGTCACCATCCGTTAGCTTAATCACCGTCATTTGGTTGTCCTTCTCCATATTACGGATCCATTTGTTTGCTTGGCCC
TGCGGATCAATCATCAGTGGCCATCGACGCGAATTGAAGACAATGATGCCGTTATCAACGGAAAAGCCGTCGGTCGGAAGTCCATCAATGTTCCACTTGC
GGATTTGTACCGCGTCGCCAAGAGATCCGTTCAGTGATGGCAGGTCACTGCAAGGAATGTCAAGCTGCTTGCAGCGTGCAACCCAGTCGTGTACGGCATC
CTGGCGGTATAATGAAGTGAATGGACCGAGATACGCAACAACTCCTGCTGAGATCAGCACGTCTCCTGTCAGTCGGCTGTACTGGATTGCCAACTGCTCT
GCAAACTCAGTCCAGCGTGTCTTTTCTCCCCCAAGGCTTTCGATCAGCGTGGATGCTCGGACAAGCTTTTTACCCGTGAGATCCACCTGGTACTCGAGGT
TTTCCTTTTGCTTAGTGGCGGAGTCAAACTGCCGCTGTAGCTCTGCTAGCCCGTCCTCAACCTCTTTCAATTGTGACAACTTTTCGTTCAGCTTTTTCAT
GACCTCGTCAAGTTGCTGCTCAGCTTCCTTTAGCGCTTCACGCTTGGGCGCAACCACCTTTGAAACGTTGTCGTACAGTGCCATAGCGTGCACCCATTTG
CACAGGCCTGCTGCTGCTTTTGAGGCCTTCTCAGCCTTTTCTGGACTGAAATTTTCATCGGCAATGTATTTGCTGTTGACGATTTTCATCGTTTTGGGGT
CGAGATTGTCCTTGTCGAACTTCTTCAACGTGGTGATGAAGGTCGGGTCGCTAAGCATTTTCTGCGATGGCCCCCAGTAATCCATGATACGCTTAGAAGG
GTCTTGCGGGTCTGGAATACGGGCTGGTTTGATACCAAGCATCACACAAACACCCTCGCACACCAGTTTCACACCTGCAGGAGGATTACTCATGGCTTTC
ACCTCGTTGATCTCACTTGGTTTGATAGTATCCAGGGCTTTTAGAGCCTCTTCCAGTGCTGGAATTGCTTCCGCTAGATCTGCTTCCACACTGGCCTTCT
GCTGCTCGCACTCTGCCTTAGAAGCGTCGGCCACTGCAACATCAGCCTGCACTTCACTTCGCTGCACTTCAACTCCAGGCAACTTAGCTTTGATTTCCTC
CATCAAAATGTCTGTATCTTTCTTAGACTGGTCCAGCACAGGTTGCAAGTCTTCGAGCTCCTTCCGCATCACCGCCACATTGTTTTCTGCAAAATTGATC
TTCTCGAGACCAATAACATAGCGATTGCGAGCACTTTGTACGGCTTCACGACGGCGCGCCAGGAAGCTTTTAAACGCCACGATGAGCTCTAAATAAGAGG
TCGGGGTCACGTAATTCTGGCGGCGCAAATTCTTTAGGAACTTGTCCGAGAGTTCCATCACGCTTACGTGGAAGTATTGGCATGTGTCCACAATGGCTTT
GCGAACGTTGGCGCTGTCCATTTCCACGTCTGCTAAGAATTTTTCGGCCACAGCCACCAAAGCATCGGACGGCCACGCAGTGAACCAGTCAATCGTACAA
CAGTTAATTAGCGATGGAAACTTTCGTAGTCTGTCCCTGAAGGCATCGCCGATGGGGGAGCAAGCGAGCACAATGTGCAAGTTACTTCGCACTCGCTGCA
GGAAAAATGCATATAGCTGGGTTTGGTTCATGTTGTCTCCCACTGCTTTACCGAGTTTTTCCTTTACATGGGGGCGAACAGCTTCACAGATACCGACCCG
TTCGTCATACGGGAACAGATTTGGAATCTCTCCAGAGTTCAGCATATTGTTAATGTCTTCGACAAAGCCATCATACTTGATCTGCGTATCGCTAAACAGG
AATACAAGTGGTCGCGCACCCGTACCAGCCATACGTAAGACATCCTTCATATCTTCACGCCATTCCGTCATGGTATAGTTCTTCGAAATTTCAATCTGCT
TGATTTCAAAATCAACGATAAACGCCGACAGCCGCGTAAGACTTTGACGACCACTGCCACCCACGCCAACAAGAAGTGCATTTCCACCCGGCATGTTCAG
CACGCGAACAATCCGCGATAGGTGTTCGATAGCGAACAGAAACATAACCAGGTTCATGGGTTTCCGACTAATGCCATTGTACTCGGCCAAGTACCCGTCA
AGACACTGGATAAGCTGCGCGATACCGTCGAAATCGGTGTCCAGACGAACATCCACTTCTTTGTACAGCCTCGGACTTGCATCAGGGTCCATGTAGTCGC
CAAAGAACAGGTTTCGCATATCACCTGCTGAGACTGGACCTTCACAACCGCGTTTGAGGCTAGCAAATACCTTGTCAAAGTTCGTAGCAAAGTGCTTGAT
AGTGATTTTCTTCTGCACGTCGTTAAACCACTCCCGGTCTTCATCGTCGATCAAACGGTCACCGATCACGCGAAGGGATTCGTGCACCCACAACTTCACC
AAGCTGTTGGCATTAAACTGCTCGCTAGGCACCACAAGCATGATTCCTTGGACGATTCGAGAGAAATCCCGAAGGTTGAATGTATAATGCGACTTCTTTG
GAGTGGGGAGGAGTGCACTCATAGCAGACTGATACAGCTCTAACGTTGCAGACACCACGGCTTCTGAGAGGCGTTTCACCTCCGGGATGAAGGGATTTGA
GCCAAAGTACCAATCCAAAATGGTAGTGAAGATACGCGTGAGTGTCGTGTCATCGAACTCGGAAAAGCACAGAAGGTTGAAATGGCGAAGTAGCCGAGGA
GTGACGCTGTTTCTTCCGCCACCAGGTGGTCCCATCGCTGCTAGCACAATAGTGTCAACAATCTTTCTCCATGACATTTCTTTGAGATCGTAATAGCCTT
CACTGTCTATCAGCTGCCTCACCAATTCAATAGGTGGCTGAGCACCGTACGTTTCGACTAATGGCATATTCAGGTCGTCTACGAAAATAATGGCGTTCTT
GCCCAGGGGTGGGCCGAACACACCCTTGCGGCGCTTGTCGAGCTTTCCGTCGATAATATTCTGGGTCATGTTTGCCGACGTTTTTGCCGAGAACGACAGC
ATAATGACGGAATTGAGATCCTGAGGCAGTACCTCGTTCAGAATTGAGGTCATGTAACAAGACTTGCCCGTTCCTGTTGGGCCACAAACAAGCACCTTTC
TTTTGTTGGACACGAGAAGCTGAACGAGATACTCCAACTGAGCGGTGAAGATTGTTGGCACAACAATTTGGTTGAACGGCGTATTGGGCTGAATCACGTA
TGGTTTGAGCATCTCCTCCCACTTGAACCACTTGCTCTCTTCAATGTCAAAGTAGTAGTCGTGCAGGTTGCCCTTGCCAGGCATTGGAAGCGCCAGTACG
TACGTGTTTTTGCTGTCTTCAAACGCAGGCTTCTCCCACTTGCGAACCTGAAGTGCACGGCTTACAACAATATACTTACTCTCCAGTGCTTGAATATTCT
CCATAATTGAGCGAACGAACTCACAAAACCTGATTCGTCCTTCAGAATTAATGCTCTCACCAACAGACCACGTGAGTGAGAACATGAAGAGCGCTTCGAT
CATCGCCTTTTTCTTGGACGCTGCATCTTTTGGAAGCTTGCACAATTGTGCCTCAAAGATGTGAATGAGGCTTTGCACAAGGTTCGTATCCACGGTCGGA
GACAGCTCAACTAACTCCTTCCTAACAAAAGCAATGCATGGTTCGACGAGCCATGAAAACAGGAAGTAGATGAGGCTCCGCTGGTCATTGTTGATTTCAA
ACGGGCCCAAAGGAGGTTCCTTGGTACCTTCCACCAAGGTGATAGAGTCCAGCCATGAATTGAGGACTGGAATCCAGCCCAGTTGCTCAGGCTCCATGTA
AATCATGCCACAGCGAGACACTGTCGCAGGTGACGCAACCAACAAGTCCATGGGTTCAAACATCATGCTCATGACCGAACTCATGGCAATAATTTCCCCG
CTCATCAAACACAATTTGCGGTTATCATCAAGCACAGTATTCATGTTTTCAATCCATACAGCATCCACCGGTCCATCAAACATTAGCCACTTGCGATCTG
GTGAGGGATTATTAGCCAGATTTCTGTAGTTAATGGCAAGCACTCCATCATTCCATTCGTGAGAAACGGCATCGAATTGTCCATAGAGCTGCCCCATCGT
TACCGACTTGGGGTTGATCACTGACACGATAACATTGGTATACCGTTGATCGTTAGGAAACTGCTGATGCAGATGAGCTAACACTTCAGACAGCACTCTC
CACGAGCACGTTTTCCCTGAGAATGGCATTCCCACCACCATGAACCCGTGTCGCACAATCATCATTTCGTAGATTTGAATCACCTTCTCGACAAAGTTGG
GAACTGGTTGTAGATTCATTTGTTTGCATACATGGTCGATCGAGCTCAGCATGTCTCTCCGATCTGGTGGATCGATCGTCACGCCAGGGAAAAGATCCGA
TACAATACCATTAAATAGAGGTACATCGGGGGACAAGAACTTCGGCAAATTGACGTCAATGATCGATCGCAACACTAGAGTATCTTCTCGCAGATGTCCT
TCGGCTCGTTTCAGGTTACCAGCAGCTCTAAGCACAGCCATGACAGCTCGCATCCCGTAGTCGTAGTGAGATTGAGATGACAGCTGTTCGGAGCACAATG
TGTAGGTCGTCGTAATCTTCTTGGAGAGAGCGCTTGCATCCATGTATCCGTAGGAGTACAACATTATCTCTGCAATCATAGCATAGTCCGGAACCATCAT
CGCTACAGTGCGGAACAACACCTTCAAGTTGTCGGGTAGCTCTGCTCGGCCAGCATATCCGGGGTTCATCGTGATGAATGGACAGCAAGTAGGGTTTAGT
CGGAGTTCTGTGCCCTCAAAAATGAAATTTGCAAGGTTTTGAGCTTTCGCCAGCTGAATACAAAGAATTTGTTGGGCAATCACCGACAACACCTCCAGCT
GAATACGATTAAATTCGTCGAAGCACGCCCAAGCACCCGAGCTCGCAAGACCCTTGAAGAATTTTCCCATTGCGAGATAATCAAGACCATCAGAACAGTT
TGTGACGACGCATTGAATGGCAATAGCCTTTGCAAGATCTTTCGTCGTCTCTGTCTTGCCTGTTCCAGCAGGACCCTCCGGTGCACCACCAAGGTTGAGG
TGAATCGCCCCCGTCAATGTCCGGTAGCACCTATCCGTCAATGGGGTGATCACCAAACGCATACTGTTTCCAAGATACTCGAATGCATACAGGGCCAGTG
TGTTAATCATTCGACACTCAAGAGTATGAGGCTTACCTGTTGTCGCCGAGACCCCACCCTGGATCCAATAGTATCGCAGTTGAGCAAGCCAGTCGAAATC
CGTTTTATCCGTGATTTTCAGATCGACCAGCTCGGCAATCGTATCGCGGTTGTGTACATCCATCACCACAAGCGCTCCAAGCGTGATGCGAATTAGCTTT
GGTAGCTCTCCACGCACCATCTCGACGGTTCGCTTTAGCTCTGTGCGCAGCATTTCCAAGTGGTCGCGTAGTGCATTGTGGTCATTTTCACAACCACTGA
GCGCTTTCTCGCTCTGTTGAGTCCACATCGTTTGGTTTACAGCCAGTACCACCTGGCCAGGCCACTGCTGCACCCATTCCAGTCGATCTTTTGTGGGGTA
ATCCATAATGGACGCATCTAAATGGAAAGCAACACTTTTCTTCATTGTCATCTCGACTTCCTCGAGCCAAATCTCTACATTTCCTCCGGAATTGTTCGGG
TTGATGAGGTTTTGAGAAATCTTTTCGTAACGGAAAGGAACCTTTTCCATCTCAGGACTGAGCATGGCAGTGATATCTAAGTTGTCCTGGAATTCAAGCT
GGGAAATACCATCAAATGCTTTTTTGAGGTGAGGTTGGACCCGCAACGGGTCTTTCGTTTCGGCAAGGATTTCGAGCAACTCATCATTCGACAAGAAGAA
GAAGCGCGGAAAGTAGAGCCGCTTAGTCTCCAAGTAGTCGTTGAGACCTTTTTGGATTGTATCTAAGTCCATATTCGACTGCTGTAAGCTTGGTAGTAAA
TCGCTGCGTTCTGCCACTGTCAGAACACCAGGAGAAGCCACGGTTTCTTGCATGTTACGGCGCCAATTCGAGTCAACTTTGCGAAAAAGAGCGCCCTCGG
TGGGCATTTGCCGCATGATATCGTCAGAACTGAAGATCGGTTCGAGATACAGCCACGTAGCCTGCACCTTAATCCAATTGTCCATAATGTC