Description :
From Genome Similarity Track
Location :
contig_6:142122- 159422
Transcript NameFunction/comments
g2215.t1ETK77692.1 hypothetical protein L915_16086 [Phytophthora parasitica
g2216.t1RAW37592.1 hypothetical protein PC110_g6155 [Phytophthora cactorum
g2217.t1RAW37591.1 hypothetical protein PC110_g6154 [Phytophthora cactorum
g2218.t1ETK80339.1 hypothetical protein L915_13968 [Phytophthora parasitica
g2219.t1RAW37585.1 hypothetical protein PC110_g6152 [Phytophthora cactorum
g2220.t1RAW37588.1 hypothetical protein PC110_g6151 [Phytophthora cactorum
g2221.t1KUF81900.1 hypothetical protein AM587_10009389 [Phytophthora nicotianae
g2222.t1OWZ20704.1 hypothetical protein PHMEG_0004840 [Phytophthora megakarya
g2223.t1hypothetical protein

Sequence
17300 bases(100 bases per row)
ATGGTCAAGACGGTCGTGGGCAGCGGTCAACTCGCCGCGGCTTTCAGCGTGGGCGTGGCGGCTGCAATCGCGGCCCAATTCGTGTACCAGGCCACACTAA
AACATCGTAATGGCAGCACTCACGCTGCAAAATCCGTGACGGGGGCGCCGCGCGGGACGGACGCAACGGCGCAGGAACTGCTGGAGGAGCAGCTGTCGCG
CATCGCCGCCTTCTTCGGGCCCGAGGGATTCGCCAAGCTCAAGGACGCGTTCGTGGTGGTCGTAGGCCTGGGCGGTGTGGGGTCTCATGCCGCGCACATG
CTGGCGCGCTCGGGCGTGGGCAAGTTGCGGCTCATCGACTTTGACAACGTGACACTGTCGTCGCTGAACCGCCACGCGGTGGCCACGCGCGCCGACGTGG
GGCTGTCCAAGGTGGCTGCCATGAGGCGTCATCTGCTGGAGATCGTGCCGGACTGCGAGATCGAAGACATGTCCGTGATGTTTGAAGCGGCCAGTGCAGA
CGAGCTCCTGGAAGGTGAGGGGAGAGCTTTGGTGAAACAGTGGAGGCCTTGAGATCTGATTGAGGTGGTGCGCTTTATGGCGAACAGGCAACCCGACGTA
CGTGCTGGACTGCATTGACGATGTGAAGACCAAATGTGCGCTGTTGGAAACCGTGACGCGCAAGAAGCTCAAGGTGATCACAGCCACGGGGGCAGGTGCC
AAGGCCGATCCGACGCGTCTGCAGATCGGCGCGCTCAAGGACGCTGTCCGTACGTGATGGATGGCGTGAAGATTGCGTTGGTTGTTTGGAGTGCTGATGT
TCTTGCGCTGTTGTGTAGGAGACCCGCTTGCGACCAAGATCCGGTACTTCCTGAAGAAGAAGGGTGTTGCGTCGTCGGATATAACGACCATTTTCTCGAG
CGAGAAGAGCGTGTGTAAGCTACTGCCTCTGGATGCCGAGCAGGCGGAGAATCCCGAGGAGTTTGGCAACGTGGACAACTTCCGCATTCGCGTGATCCCC
GTGCTGGGCACGATGCCCGCGCTTTTCGGACAGTCTATGGCGGCGTACGTGCTGTGTGATTTGGCTGGCAAGAAGATCAACCCGGAGGCGGTGGCGCGGC
TGTCCCGAGACCAGCGCAACAAGCTGTACCAGCAGTTACAGCAACGCGAGCACGTGTTGTTCCACGAGGGCCACAAGATCGAGCTGCAGAAGGACGAGGT
CGAGTTCATCTTCCAGGAGATCTGGCGGGGCCACAGCTCTGTGGGCAGAGCGAGAAACGGCGGCCACGACCGTCTGTACCTGGCTCGTTGGCGGGCGGAC
CGCCCGCTGCGCCCTGACAACGTGGTGTACCTGACGACGAAGGAGCTCGCAATTCTGGACAAGGACGGCATCGAGGGCTTCGACCCGGAAGTTGTTGCTC
GCATTGATGCACGACTGAGCCAGTTCGGCAGCTGGGCTGCTCCTGAGTAGAATTGTCCTACAAACTAGAAACCAAGCTCGTGCGTTGGTGCTGACAGCAG
CAAGTCGAGCTTGCATGTATCGCCGCTTTAGGTGAATAGACGTGATCTAAAATGGACATTTCACGGTACTACTGTGCGACATGTGCCGAGTACGTCATTC
GAATTTATCTTGGTTTTTGTATACTTTTAGCCGATACGCCCAGTCGAGTCTCAGTTAGCAATCCCCCTCAAGCTACACACACCAAGCAGCAATCCTCCAG
CATGGCCACCGCCAAGAAAGTGACCCAGAGACTGACCGCCGAGTCCTTCAAGCAGTGGATCCAGAAGCAGGACTCCTTCCTCTTTGACTGCGATGGAGGT
GCGTGGCCCATGGGCGTTTGAGCTTTGACACGGAGGCTCACGATTTGGATACTTGTGCCAGTGCTGTGGCGTGGAGCAGCCCCGATTGAGGGCGCCGCCA
ACATGATCAACCTACTGCGCTCGCTCAACAAGCGCGTGGTGTTCGTGGTGAGCTTGATATGACGTGACTTGGGGGGTGGCGGAGATTGACACGCGAGGGG
ATGTTGTGCTTTCGTGCAGACCAACAACGCCACCAACAGCCGTGCCACCTACGTGAAGAAGCTCGGTATGTGGCGCATCGCCCTAACTTTGTTGAGATTT
CGACTAACAGGGAGAGATCCGTTTGATGGGATACAGCTTCACAGGGCATCACTGCTGTCGAGGCCGACATCGTCACGTGAGTCGTGCATTGGTTGATGTG
CTTCATGGTTGGAGAGTATGCGTGCTGACACTGCTGTTGGACAGTTCGGCGTGGGCCACGGTGCAGTACATGAAGCAGCACAAGATTGAAGGCAAGGTGT
ACATGGTGGGTGAGGTCGGCCTCAAGACGGAGTTGGAGCTGGAGGGTTACCAGGTCAGCGGTCTGGAGCACAGCGACATCAAGGGTCTCCCGCACGCTCC
GGATATTGACATGGAGACGAAGGCGGTTGTGTGCGGTCTGGACAGGTATGCCATTGGTTTAATTGGTAGTAGTAGTCTCTTGAGCTGACATGCTTTGTGC
CGTTTTTCAGGTACTTCACGTACTACAAGATGGCCTACGCCACGGCATGTGTCCGCCAGATCCCGGGCTGCCGCTTCATTGGCACCAACCCGTACGTTTG
TTTATGAATGATGCGATCAACCACGCTGAGGTTTCACTCACCCAGTTCATTCTTGATGTTTGTGTAGTGACCAGACGTTCCCGACGGATGGCGCTATTAT
CCCTGGCGGTGGCTCCCTCGTCCACATGCTGGAGTGCGCCATTGGCCAGTACGTTCGTGTTGTTTCAACCCAATGCGTTCTTGTCGCGCTAACTCGTGTG
CCATCAATTGCGTTCTTGCAGCCCGCCTGAGGCCGTGTGCGGTAAGCCGTCGCAGGACCTGCTGCAGACCATTATCGCCACGTACAACCTGGACCCTTCG
CGCACGTGCATGGTACGAAGCTGCAATCACAACGTGGAAATAGCGCGGGGATTGACCTTGTCGTGCTTGTCTTGCTGCTAACTAGGTTGGCGACCGCCTA
TCGACGGACATTGAGTTCGGCAACGCCGGTGGCCTGAATACGCTGCTCGTCCTGACTGGAATCACGCACGAATCGGAGCTGGGCAACATCGACAACGCTC
TCCACGTGCCTGACCACTACGTCGACTCGGTTGATGTGATCAATCAACTTCACGCCAAGACTCTTGACAACTAGAGTCGCTGACCACGTGACGTGACGTG
ACTTAGGATACGCATCGACAACTTCAATCGCCTGTGCTGGTTCAATAGACGCAAATCGGATCGATGTGGATGTTGCCGTACCGAATCACGGTTGCTGAAG
TTCATTCTCACGAGTACCTTACACTATGAACACCTAGACAAACTGCCTGTAAGCCTATACCGATGGTGACATATTCCCGGATGTCTTCGTCTTTAGTCGC
GGAATGGCTCCGCTACTGCCACTGTTCACAAAGGCGTCGAACATGGAGAAGCCACCGCTACTTGCAGCAGTATTGGCGCCACCTCCAGGAATGCCAAACC
TGTTAACGTTGGTAGTCTTCTTCGGGCGAACCGGGGCCGAATTCATCCGACGCGTTGCTTTCGCTGCCGTATCTACAGTGGCGCGACTACTTGCAGTTCG
TGGAGCTGGCGACGCAGCCCTCGGTTTTACGAGAGACGATGCGATCACAGGTGACATTAAAGGAGTTGGTGTCCGAAGGAAGCGAGGCATTGGTGACTTG
GTCAACCGCTTCGTGATCTCAAGGAACTGCAGCTTTTTGGTGGGCGTCACCTCCCCGTCTACCGCTTCCCTTGGTCTCTTTCGCGTCGGCGCTCGCAGAT
TTCCCGGGGAGTCATTGTCGCTAATAAGGCCGCTGCTGTTCAAACTAATGTTCAAGTCGCCATCCTCAATGTCCTGATTCCGTCGAGGCACGTTTGGCTC
TGCTGGATCGCTCGCTAAAGCCTTCCGAAATTCTGCACGCTTCGTTGCCAATGTCTTTGTTGCTGCGTTCCTCTGGGCTTTCTTGGTCTTTTTGCCCATC
ACTTTTGGAGTGTTTATATCTTGCATCTTGTTCATCCGAGCGAGCAGCTCAGCATTTGCTAGTCGCTGCTTGATCGTCATTTTCCCACCGTTGCCTCCTG
TTTTCCTTTTTACCGTCGGTGCTACGACGTCTTCCTCTTCCTCCACCGACGCCTTTGACTTCAATTGGGGCTTTGTCTTGCCCTGTGCGCCCTTGTTTGC
TTTAGCGGTGCTGTCCGCTGATGCTGCTGGTTTAGCTCTGCCAGCCGTGGCACCCTTCTTCGGCTTAATCGCAGTCGTGGAATTCGCTACAGCCGCCATC
AAGCTTTTATCTGCAATCGCCGCCGTAGCCTTGCCTGATTTCGCCGCCGCCGTTCGACGCTTCAAATGCTTCTTCGGGGTTGAGATTGGCAGGGGCATCG
GCTCAGGTTCGGAATCGGCTTCATCATTCTCGTCCTGTTCAGCACGAGCAGCAGCTTCAGCGACCTTCGCTTGCCGTTTGGCCTCTGCGTTCGTAAAGTT
AAAATCCAGGGGCGGCCCTCCCTTCTTCGCAAACCGCTTCTGCGGCGTCGGTCTTTTCTTCTTCGAAGGCGACGGCTGTGCTCGTTTCGGAGAACTCTGC
GTAACTGGCAGAATCAAGCTCACCATCGACGGCTCATCGTCAATATCCGAGTCGCTGTCCTTGTCCAAGGACAGCATATCCAGTAGTCCATCATCCGTCA
GCTCCAGTGGCGGGCTATCATATCCACCAAGCTCAACCTGATTCTCCTCTGAAAACGATTCGTCGTCTTCTGGCTGCACCGCTTGCGGTAAGCTAATAGG
CGTGATCCGCTTCGATGGTACAGCCTTCGTTTTCTTGGCCTGCTTCGGCTGCATCTTGGTTTTGGCCCTCTCTTTGGCCTCCTTCTCGTCCGTCTGTGAG
TCGCTGGCCGCTACCTGGTCCAGCTTCTTCTTCTTCGCCGCTTTCAACCTCTGTCTCTTCTTAAGAAGAGCTGTTTCCTTCTCAAGTTCACGTCGTAAGG
CCGCCTCCTGCTCCGTCGCCAGCTTCTTCTCCGCCTTCAGCCTCTCATTCTCCAGCTTCTTAGCCTCCGCTGTCAGCCTCTCCTCCTCTTGCTTTGCTAC
CAGCTCTTGCAGCTTCTTCTTCTGCTTCTGCTTCTCCGCCTTCAACTTCTCCTTTTCACGTCGTAGTGTCTTCTCTTGCTCAGCCGCCAGCTCGCGCTCC
TGCTCCTGTTCCTCCTCCTCCTGTTGCTCGAGCAGGCGCAGTTGGCTCTGGTACATCAGCTCCTCCTCCTCCATATCCTCCATCAACATGAACTGCTGCC
AGGTTTTCTGCAGTCGCTGGCGCCGCAGCTCGATGGCCTTCCACTACACCCCCCAAATGTTAGCGTTGCATGGGCGATATCTCAGTTTCTAACGGCACTA
CAAACCTACTTCCAAGTTGTATGCCTCCAGCAGAATCTCCTCCGGGTACAGACCGCCCACGGGGCCTGTGGCGCGGTCTGGGGCTTCCATCCGCGTGCTC
GGCTGCCAACTCCTCCTGCTCGTGCTTTAATGGCGGTCGGAATTTAAAAACAGCTGCTATGTACAATTTTCATGTGGCGTACACGTAGTTGAAGCCGTTC
TTACAGAGGGATGATAGACATGCTTCTCTCTACAAGGGCGCAGCATAATCCCTCTTTCAACTCACTTCAGTTCCAGAAAGGGAGTCAGTCGATACAAAAA
GCAAGATCAAAAACCAACATGGCAGTGGGGGGCGACGCGAATCTCTTCCAGCTCGCGGGCGGCATCTCGTGCCACGCGTGGAACAAGGACCGCTCCAAGC
TGGCGATGTGTCCCAACTCGAACGAGATCTGGATCTACTCTGGCTGCCACGCGGCCGACCCGACACAGTGGCGCAAGGAGGCGGTGCTCACGGAGCACGA
CATGCTCGTGAGCGGCCTAGACTGGTCGCCCGTGCACGACCAGCTCGTGTCCTGCTCGCACGACCGCAGCGCCTTCGTGTGGAAGTTCGAGGCCGCCTAC
CGCCAGTGGAAGCCACTTCTTGTGCTGCTGCGTATCACGCGCGCCGCCACGAACGTCAAGTGGAGCCCTGACGGTGAGTACAAGTAGAGGAAGAGGAGAG
TGCTAGCAATTGCTGACGCTGTGGTCCCATGCAGGCAATAAGTTTGCAGTGAGCAGCGGCGCCAAGTGCGTATCGGTGTGCTACTACCAGGCGGCGGAGA
ACTGGTGGGTCAGCAAGATGATCAAGAAGCACAAGTCCACGTACGTTACTGCTAATGATTGTGTCAGCTTCAACTTGATATTGAGGGTGGTTATTGGCTA
TTGCAGGGTCACCGACTTGGACTGGCACCCGAACAGCCAACTGCTTGTGACCGGCAGCACGGACCTCAAGTGCCGCGTCTTTTCGGCGCACGTGAGCGAC
GTCGATGGAGCTGCTGACGCCGGTCCGTTTGAAGCTCTACCGCCGTTTGGAGAGCCGCTGGCTGAGTTTGACAATGCCAGTGCGTGGGTGAACGCTGTGG
CGTGGTCCCCCAAGGGCGACCATCTTGCGTTTGCCGGCCAGGGATCGTCAATTCACATCGTTCGCTTTGGCGCGCCTGGCGAGTTCCCGACGATCCAGGT
AGTAGAGGTTGCTGGGTCGAGCTGTGCTTGCTGTAATGTGCTGACGTTTGTTGTTGTTGCCATAGTCGATCCGGTTCTCGCACCTGCCTCTGATGCGTAT
CATGTTCCTCTCGAACTCCGCGATCGTTGGTGTGGGTTACGACTTCAACCCGCTGCTGTTTTCTCAGGATGCCAACAACTTCTGGTACGCATTAGCTGAA
ACAATTGCATCTTGCTTGATCGGGGTTAATCGTTGTTTGACAAATGCGCAGGTCGTTCTCTGAATTTGTCGACAAGAAGCCTACGGAAAGCGCTGTGAAG
CGGAACGCGGGCGGCTTCAACGCTGGTAAGTGCAAGAAGTATTGTATGGACCGAACACTGAATGTATCCATGTATTAACAAACGCCGTTTCTCAACCCCT
CAGCTCGAAGCCTGTTCGAAAGCAAGGTGACGCGTGGTCAATCGTCTGATGCTACTCAGCATGATAAGAATATGCTGTGGATGTACGTTTAGCAATGTCG
TCGGACTCGCAGTCGTCATGGTACTAATATAACATTGTCCCCCGTTTACTCATCGCAGGAAACATGAGAGCAACATCACATGCATCCAGCCGTACACGCG
TTCTGCCTCGGGAAGTGTCTCGGAATTCTCCACTTCAGGTACGGCTCCAGTAAAACTTGGTCGAGCGTTTGTTTGTGGTTACGTATCACTTATTTAACGT
GCGCATGTGGCAACTGCTACTGTATTTCATAGCGCTTGACGGTCGTGTTGTCCTGTGGAAGCTCGGAAGCCTGAATGTGGAAATGAGCAAGCTGCGTCTC
TAAGAGGATACGTTTGCGTAGTAGCCCGACAAAGTTAAAGCTCTTCACCGTTGACGAAAACAGCAATTAAAATGCGCTAGCATCTACAGAAGGTGCAAGC
AAAGCGAGCAAGACACAACAAGATCATGAAGGCAAGCATTTCAACTTGTCTGTCGATTGGTTGCTCCTACCTACATACCCTCTTTCTCCCGTACTATAAC
AACGGCAACGACAGCTCTATTCGTACATCCGCTTGAGCCGTCTATAGTCTTGACGATATTGGTTCTCAACCATAGATGCGTGACGGAAGTCCTTCCACTC
AGGGAACTCCGTGAGTAGAACCTTCGGGTCGAACGAAAGCAGTAGCTGGATGCCCTGGCTAACGTCATTCAGCGTGCGCGCGAGATCGATGTGGTCTGGG
TTCAAGTACGCTCGCTGCAGCTCAAGCAGCTCGTAGCTACTGCGTAGGAACAGGATCGAGTACTCGCACACCCGCTCAGTCTTCGCACGCAGCAGCAGGT
CACACGAGTCTGCCACCAGTTTGTGGATGCGCATAAATACCAAGTGGTCGTGGGCCACGATCTCCAGAGCGTCGGACAGTGTCTCGAGCGCCACGGACAG
CGCAGAAGCAGCACTCTCCGGGTTCGTCTTAATAATCTCCTCTGCACCCACCAGCACCTTCTCCAGGTCCTGCATGCCTGGCTTCACGCCATCACTGTCA
TCTGCCGCACTCGGCGGCGGAGGCAGCACACTGTCGCCTCGCCTGCAAAGCTGACAGCCGCACTTGAACCCGAACTGCTCCCACAGATTCTGCTGCCGGT
TCTCACGACTTTGCTCGCGGGGGTACAAGTACGAAATAGTGAGCTGCTCGCCCTTGGCGATGGGCCGAGCCACTCTCACCTCGGACACGCCTCCTTCCGG
TCCGGCGTCCTCCGGTGTGAACTTGACACAGTTCGGGTTGCAGTCGTGATTGAACATGGCGTTGTACAAGAACACACCACTATCGAACGCATTGCACTGC
ATGGCGAACACGTTCTGCAGCACCTGGTTGTGGGATAGCGGCAGCTCGCTGAAGTTCCGGCACAGCTCGTCGATCTGCGGGCCGAACTTGTCTCTGCCTG
CAGCCAGCAACTCCTCGGGCAGTTCACTCAGCTTCTCCGGGTACAAGTGGCCCAGATGCTCCATGATGTCGACGTAGTCCGGTCTCGACAGCACCGACTC
CATCGTGGCTAGGAAGAACTCCGGGTCCGACGTGTCCACGTCACTCGGCCACGGGATATACACCTGCTCCACGAGCACCTGGGTGCCCGGCACGAGGTCC
TGCGTGGCCACATATCCGCGCGATCCTCCGACTCCGTCAAAGCTGGTCGCCAAGTCCACGGGCCCCACCGCCAGCGGCTTCACGTCGTCCCAAGGCTTGT
ACAGACTGCGCGCGACTTGGCTCGAGGCCTCTTCCTCCTGATCCACAGCTGCTGGGCGTGCAACAGGCGCAGAGACGATGTGCACGACCTCGTGCGGCGT
TACCATCGAAGCCGATGTCTCCTCATCGCTGCTGTCGTCGTCGAAGAGCCCGAACGCAGCCTGCACCGACGCACTTGGCTTGCCACTCATGACGGTCTGG
TTGGCCCGGAACTTGACTTGCAATGATTGTCGTGTTACGTACAAACATCAATCGTATCAGAATGATTGCATTGTTATGTATCACACACCATGATTGCACC
TCCATACAAACACCAAGTGAATCTGGGGCATACCGACTCCCTGGCTTTTGCGAGAAATGGCCGAGCACCTGGCTTCTCAGCACGAGAATGATAGCCTCCC
AGTGCGCCCAGGGCTCCCCCTTGGGCGCCGCATGCGGTTGACGCTGGGACAGAAGCGCGAAGTGGTGGACCTGGCGGCCAGCAAGAAGTTCACGCACCGC
GAGCTGGCCGAGAAGTTCCGCGTGGGGCGCACGACCATCACCAATATCTGCCGACAGGAAGAACTGATTCGATCCGAGACGGACTCAGCCGACGCTGCCA
AGAAGAAGCGCAAGACCACAAAGTGCACGTACGACCTGCGTGTGCTGGACGAGAGTCTACACAAATGGCGCATGGAGGTGAAGGTGAGCAGTCCTGACAC
GAAGCTCACGGGCACAGTACTGCAGCACAAGGCCATGGAGCTGGCCTGCAAGATGGCCGACGACCCGTACGCGGCGCTTCCCGACAAGGTCAAGCAGGCG
CTGCACAAGTTTACGGGCTCGAACGGCTGGCTGGACGGGTACCGCACAAGGTTCGGGTCTTTCAGCAGCAAGCAGCTGCCTGGAGGAGGCGACCAGAGCG
TCATCAAGAGCGTGGACATCCAGACGAGGCTCAGAGAACTGCACCACAGCTTCATGAACGTGCAGCTCGAGGACATTTGGACGGCCAGCGAGTTCGCAGT
CATGTACAAGCCCCCCGCGCCCGTGTCTGACGGCAGTGCAGCAGGGAGTAACAATGGCAGGTACACGGTTTCGCTCTTTGTCAGCGCGGCTGGAGAGAAG
TTTGATATGCAGGTTATTGGCATGGATCGCAATCCACTACTGCTGGAGGGAATCGACACCAAGGAGACGTACAAGATCCAGTATGGCTACTCCAAGACGG
GTTGGCAGGTCGCGCAGACGACAGTGAGCATGCTCAAATCGCTGAATGCTCTCGCAAGGGAACGCAAACGCACGTTCCGCGTGGTTTTGGACTCGGCGGT
GCCCCACGTGAAGGCCGCTATGATTCTGGACTCACAGGGCGACCAACGAACGTTTTTCGTGTACGACCACCTCCAAATCTACTTCTTGCCACCGAACTTC
AAGGCCCCGCGTTTCCACCCGTGCCACCTTGGCGTGATTCAAGCGTTCAAGGCGAGGTTCCGCAGTGAAATGCTCGAGACGCTCTTCAGTAATTATCGAC
AGAGCGTGATCAGCCAGGACCCGCGCGGATTCCACCCGCAGCGTCACTTGCATACCCGAAACGTGTTTCACTGGTTCAATGTGGCTCTGCGTAGCCTGGA
TAAACAGCTCATCCAGACGTGCTGGGTCCAAAGCGGTCTGCTGCCCACTCAGGCCATTGCGTCCCTCAACTTACGCGCCATATTGAGCAATACCTCGCCC
ATGAGCATGACCCCCAATACCTCAACTGGTAGTGGCAGTGACAGTGGCAACGGAGGTGCAAATTCCGATGTCAATGGCATGACCCCAAATGGAGCGAGTG
GAGCTGGCTCTACAGTCGTAGCACACGCTACACAAGGAGGCCTGCTGTCGCCCGCGGTACTCTATCGCGATTTACAGTTGCAACTGACGAATATCGCCCA
GCTCGCTCCGGACTTCTTGCGCTGGATTGGCGTGAGCGATCCGAGCAATGCGCAGGCATTTGTGGAGCTGGAAGGCAATGCTTCCGTAACGGACCCCGGC
ATCGATGAAGTGCAGATCATCCGCGGAGTGCTTCAAAAACATGGCTACCTGTCCACAAAAAAACTCGATGATGAAAGTCATGCCGAGGGTCCGTACGAAA
CCTTTGACGACGTGGCTGATGAGCCCTGCCCAAGGCATGATGAAGTTGTGGCGTCCATTGAGATCCTCAAGAAGTACCTGAGGCTGTCACGGGACGCAAT
CCCAGACCGTGTCGACGCTGTAGTGCAGCTGAACCAAGTCAAAAAGGCGATTAATGCTGCTGCCTTTCGCGACGCCGCCATCCGGGAGGTATGAGTGAAA
CCCATTTGACGGAGTGGAATGTGCGGTACTGTTTTATTCTACCTGGCATCATGCTCATCGTTCTCATTGTATTGTCACTGTTGTCGGCTCTATCTTACAT
ATGCATGGCTCTCGAATATTGGGTGCCCTAGCTAGTACACAGTCCGGATTCTGTAGTTGGGAGGCATTGCCGCCATCACGGTGTTATCGTCTAGCCGTTG
GTTCGTCTGGGTTGGCAGCGACGACGACATCCGAGCAGGTGGGGTTGACTGAGGCAAGAGATCATCGTCAAGCGGCAGGATAGTACGTTCCGCAATGGCC
TGCTGCTCAATGCGACGTTGGCGCCGTGCGTATGCTACGAGTGTGCGCAACGCACTCACTAACCAGTCGCGGTGGCTTGAGCTCTGGGTCTCAAGATCTA
GTGTACGATCCCGGAAAACAACCGAGAAAGAGCACGCCTCGAGCACGCTGTTGGACGGGTACTTGCGGAACACAGCCGTCTGTCTACCGTCCAGCACCTG
CAGCACTTCTGCCAAGTCAACCGCTCCACTGAGCCCGCCTCTCTTGTGCTGCCACTGCAGAGTTCCGCAACAGTTGCAATGGAGTCGGGTAGCATGAGCA
CCGCCACGACGCCCATACTTGAGTAGAGGGAAGAACATGTTGATTGCCTGCACGAGATACGACCGGTGCTTACCGCCAAAGCGGAAGGCCAGCTCCACGA
TCTTCCACCGCGCACCTTCGATGGTCTCGAGCTCTTCGTCTGTGAACAAATACGTTTTGCGCTTCTTGCGAAGATGCAGCGTCTCCAGCACGCGTGGGCC
GATCCTAGAGAACGCACTCTTCTTGTGTTTCTTCGCAGGGTGCACTTCTTGTGCAGGGTTAACTAGCGGCGGTGTCGGCATCGGAGACCCAACGAGCGGA
GACAACATGTCAGTTGGCTCCAGGTCGTACGCATTCGGGCACGACCCAGCTCTCCTCCGCATCGGTGCAGGCTTGGACTTGCGACGGACTCCATGAGACT
GGGCCATGGGTGTGCTCAACTGGTCCGAGTCATCCTTCAGCTGGATCACCAGCCGCCGCACGCTCGAGGTAAGTTGATCCTGCGCTGACAGTGCAGCTTG
CTCGGCCGCGCAACTGAGAAGCCGAGTGCGTCGGCGCTGCAACAACCGGTGCTCGGCCGGGCTCAACTGTACCAGCTCGTGCTCGACCTGAGACGTCGCC
TCTTCTACCTCGCTACTGGATCTTCCTTCGTCGTGCTCGGCGTTGTTGTCATCGAGGTCGAGCTCCTCCACGTCGTGGATCTCGTCAACGTCCTCGTCGT
AGTCCTCGTCCTCATCTTGGTTGGACACCGCAGCCGTCGCGCTAGCTACCGGCTCACCCGACTCGCTCATCAGACTCTCGCTCTTGATCCTGTTCACGAG
CGTGCGCACACTCGTCGACATGTTCAGCAGGTCAAAGTCCAGCAATTCCTCCTCATCGCCAAAGGCTCCACTGTCTTGCTCTGCACCCGCGTCCGCTCCA
AGTGCACCCGCCGTTCCTCTTCCTCGAGGTCCTCCTGCTCATTATTGCCCCTTTCGTCCGCCTCCTCTTCGTCTGCCTCCTCCTTCTCCTCCTGTTCATC
CGGTAGTAGCGCCAGCAGCGGTGCAAAGCTCGCGTGCATGACTCCGAAAGTGTCAATCTGCGTCTCGAGCGCCGCTCTCCTCGCCAGCTCCTCTTGACTC
AACGGCCGAGCCAACGCCGCCGCCACTAGCGGCCGCGCCGGATAAAACTGGAACCGCTGGCCGTTGCCACTGCTGCTGCTGCTGTTACTGGTGCTCGGGT
CCCACATGGTCATGGTCGAGTGCGTGGGCGTGGCGCCGACGCTGCTGCGCCGCCCGTGCCGAGCCGCCGGAACCGTCGCGACGTCGGCCGCGGTCTGTTC
CTTGTCCTCATTGCTGCTGCTGCTGCCGCGCGCCTCCTCCGGGTCCGCCTGGAACAGACTTCCGCGCCGCACGATAGCCGACAGTTTGCCTAGCAGCACG
ACGCTGGACGAGCGCTCGCGGCGTCCGCCCGACCACGGCTGCATCGAAGAGGGAGAATCCGGGAGAGTGGGAGCAGCCTCCACCCCAACGCGAAATGTGG
GCCGAGGAAGAGGGAGGAGGAATGAGAAAACCGCCGTGCAGTAACAGGCTGGCACGAGAATGGCTGCAACTGGAAGCCTGCAAGATAGATAACTGCACTT
GTGACCGAGTGGGCGTTTGCCAAGTCAAGGAGCCGTTGCCGAGAGTAGGTGTCTTCAATGTGCAATGGCTGTAGCCATGTCCGTTTTTATCAACTCTGCA
AAGTGCTGTTCCGAGCCAGCCGCTGTGTTCGTCCACAGAAGGACGGTATCAACTCGGCAGAGGGGCAACCGAGTCGCAGCTTGGCAGGATGAAAGCCGTT
ACCGGACTCCACTGGCACCTGGCGAGCGCTGCTGGCCAGAAAGCACCAAGAAGACGGCGGTCCTCGCCAGAAGTCTGGTCTCTCGCCGAGTCTCACGGGC
TCCGATGCCCTCTATCTCCACTAGCCAGCCCTGAACTCTACTGCCCACTCCTTTCAGCCGCAATATGCTTGCGGTTTGCTGGACTCCCCAAGCCGCTGGT
CTTGCCTCATCGCTGACGTACTTGTGGTACCACTTTCCGGGTACGGTCTCCGTAACGGCCAATAGTCAACATGGTGAGTGGTGGCAAGACGCCTCGTCGC
GGCCCCACGCAGCGCCGTGGCCGTCTCCAGGGAGCAGGCGCGCTGCTGCAGAGCAGTCCCGACACTGCGTACCCGTCCTCCCGTTTGCTCGTGTGGCACT
CGCGCTTCACACACGGTGCGTCTCGCCACGAGGCCGCCGTGAGCGGCCACGCTTTCAACCAGCAGCTCGAAGTGTATCTGCCTTCCAAGGCCGGGAAGGC
CACGGCGCAGTCACTGCAATGGGAGACGGGCTTCTACTACGAGATTAAGGCGTCGGTCGGCATGTTCCTGTCACCGGCCTTTATTAAGGAGTACCTGCAG
GACGGTGGCTCCGTGTTCATGGTGGCCAAGAACGTGGCGGTGGACGCCGCGCAGTCGGCGATGCTGCTGCCTTCCGGCCAGTTGCTACTACTCGTGGATG
CAGACACGTACCAGCAATTGGGCATCGTGGGTGAGAAATATGGTAGAGCGCTGCCTGCCACGAGCAGGACGAGGCGGGGGCAGAAGTACTCATCACGCTC
GATTTGACGTCGTCGGCGTTTGCAGAGGAGGGGGAGAATGCGTTTAGAGATCGAGTGAGAGAGTGTTTGAGCAGCAGACTGGAGGACCTCGAGATGCTGC
TGTGTGCTTACAACGCTCGCGGATCAGCACGTACGATCTTGTTTGGAGACGATGATACGGTGCCTCGAAAGCGCGTCGAGCTTGATGGACAAACGACGAC
GTTCAACGAGGTGTTTCTGCCCAAGTTCGACGCGTTTTATGCTGTGTTGAAGAAGAAGGGCGAGCGTGAGGATGGGGACAATGATAAGCTGCGGACGTCG
CTGCAGGAGGCATACGACTGGCTGGGCCTTGTGGCCTGCCGGCTCACTGACTTGCTGGAGAGACAGAAGCTGGAAGAGTACGTGTCAACCTTCTCGGGCA
TCCCTGATTCGTTCGAGTGCGAGCCGGATAGCGAGATCACGACTGTGCGGTGGCGTGGTCTGGTGGCCGCTCCATTTTGCTCGACTGTTGTCGAGAAGGT
GCAGCGTGCTGTGAAGAACAGGGAGGTGCCATGGGGTGCAGTCACGGTTTGGGGGTTCCCGGACGTCTTCGTGTCGTGGGTGCAGCCTGTCAAGACTGGC
AAAGGCAGTACACGAAAGAGTGAGTCGCAGCGACGAGAGCATGGCTACCTCGGAAATGGTAGCAACAACTACACCCTGCTCATGCTTCCAAACGACGAGT
ACTTCATGCTGCAGGCACTCGGTCCACACGATGCCACCGTGTAGACGACCGAGTAAGTCGAGTATCTAGTACAGCATGGATAGCACACAGGGTTACAATA
GAATAGAACGTTGCATCACGGTCGATCTTGGCTTTATCCGCAACTATCCGAGTAGCTAGTTAGCGAGGACGTTCTCGACGAACGCCGCAACAGTGGACGA
GTCCGACCCAGCTTCGGCTAGCGCTAGCGCCACCTTGATGTGCTTGCGAGCCGGCTTCACGTTGTTCTTCTTGCCGTGGATAAGTGCAAGCCGCAAATTC
GCCAAGAAGCAAGTAGCAGTATCACTGTTGCTGCTTAAGGCGGTGGTCGTGCTGCTCACATCGTCATCAGCATCTGCCGAGGTGATAAACTTGGTCGCCG
TCAATGAAGCAACGAGCTTCCACACGTTGATTGCAGCGTCCAAGGATTGCTGTTCTTCATAAAACCCTCCGAGCTCAATCAGGATTGGAACCAATCGGCT
CGAAGCAGCAGCAGCAGTATCGGCAGAGACGGCAGCAACAACGTCCACGTACTTCTGAACGGCCTTTGCCGGGTTTGAGATCGATAGCAGACGTGCTTCC
AGCAGGTCAGTGTCCACCGAGTCTGTCAGAGCGCCCCTCTTCTTGCTTTCTTTAACTCGAGTCAGTCCTTCGATTGAAAACGATGTTGCTTGATCGTGTT
CTCCGAGTTTGGCATAGCAGTAGCTCGTCAGGAGCTCCAACTGAGCTGCATCATAGTCTCGCCCACTTGCGGCAATAGCAAGTGACAATCCGGTCTGCAG
CAAGCGCAGCAGATGACGAAGAACGTCATGGTGCGTTTCTCGCTTCGTTTCCAGACCAATGCGCTTGAGGATGCTTGTGCCAGCCAGAACGTATGCCTGT
GAATTCCACGGCTGGGCGCGAATTAACTTTTGTGCGTCCAAACACAGCCCCTTTACCCCGGATGGGCCAGCCTTGAACAATCCCACCAACGAGTCCAAGA
AGTTGCGATCCACCGTGTCCTTGCCAGGGGAAGGCACATTTCTGGCAGTCGAACGCAAATACTCTCCCAGGCAACTCGACACTTGAAGGTTTTGCGAGTC
GATCGTCGCTAGAGCCAGACGCATCCATAGCGAACTTGAATTCGCTCCGTCATTGGTTTGCGACAGCGCTTGAAGGCGCGTCAGGTAAGCATCTTCAGCG
CCCACAAAGCGTTCGTGGAGCTCAACCAAGTGCAGGTTCAGATAATCGCGCGTTGTGAGCGTTGAATCAGCTTGGTCAACTGAGGACAAAAGACGCTCCT
TACACACTGCTGCAAGACCCACTGCCTTGGAGCCAAACTTGCTCATGAGCAAGCTCGCCATCGATAGACCCACAAGCGCAACGACATTACTCTCAGCGGA
CTGGGCTTCATCTCGTGGAATCAACGCGTGAAGCAAATCCAGCGCCTCGCCTCCCTTTGATTGACGGTATAGTAGCTGCGCTTGCACGATACCCTGAAGT
GCTGAGGACCCACTCGTCGCGGCAATCTTTTGCAAAAGCGCTGAATCGTCAATTCCATCGCAAGATTTATCGGAGAGCTGGCCAAGCTCAGTCACTAGCG
TATTCCATTCAAGGCCTTCTTGGTCACGAGCAGACGAAGCCGCATGGGTGTAGGACGCCAAAGCCTCGGTGTACAGTCCGAGGCGGTGCTGAGCAACACC
TAGAGCGTGCCAAGCGCGCGCATTGAACGGGTCTCGTTCTAAATACTTCTTCAGGTAAAACATCACCTGCTCGCTATCATGCTCTGGAGCCTCCGTTATC
GACTCACCGACACTAGCTCCATAGTCCAACAATGCCGTGCTTAAGCCAAGCAGAGCATCCAGATCCAACCCGACTTGCAGTGCACAGTCGAATGCTTCGA
TCGCTTTTCTCTGCTGAACCGTTGAGCTAGCTTGGCGTCGAGCCAGCATCGCATACCCATTCCACATAGATGGGTTGCTTGGGTTCACGCTCTGCAGCTG
CAGAAACGACTTCTGCGCCAACGACGCCGCTGATGGCACGGCATCAGCTTGGCTGAGGTAAAACATGCCCAAATTGGCCCATGTGGCATCGCTACTGCTG
CCGGTTTGGACTGCTCGTGCCCAGGCAAACTGCTTCACCAGCAGACTGTCAGACACAAGTGCCAATCCATTCCAGGCCAGCGAGCACGAAGGATCCTCCT
GAAGGGCCAACTTGAAATTCGTCGACGTTTTCGCCTTTAGCTTCGAGAGTGTAGCATCTGCGTCACTGTTGGCAAGACCCTTTTCGATAGAGAAAGCTGA