Description :
From Genome Similarity Track
Location :
Scaffold_8:142110- 145843
Transcript NameFunction/comments
Physo_129518hypothetical protein

Sequence
3733 bases(100 bases per row)
GTCAGTCGTGGCGCTATACGCCAGGTTCTGCCACTCGGTATACCTTCTCGACCCGACGGACACGAAACCCGGTTTGCGAGGATCGTGATCCCCAGTTAAC
CACATGCCCACCTGATCGTGGTGTTGTAGGCAGACCGGCGTTTCTCCAATGTTGGTGATCTGCAAGTATCGCGTCTTCCCCAGTCCAGCGGCCAACGTAC
GTACCCACTACTTGCCTCTTGTGAGCCATAGTTGTTCGGAGTCAGCGAGTTGTATGCGTTGCGGTAGCTCGACCGTCTCGCCCGCTGCTAACGACACCCA
TTGACCAATCGTCATCGCCCGCGCCCGGTCACTGAAGATCTGTCGCCGTCCATGTAGCTGGATCCGGATCTCGTCCGGTAGGCACATCGATCCGTCTCCG
AGATCTAGGCGGATCCCGGCTGGTACCATGAAATCCATGCCCTGGATTGCTTGATAGTCTGGTGGCAGATCGTCGCCCACCCACACGTCGTAATAGTACA
CCAGGTTTCCGACTAACGTGAGCTTAATCCTTGTTCTCCCAGTCGCCACGTACAGCTTCTCTCCTATGCCGAGACACTCTTGACGCTGACTTGTATGTAC
ATAACATCCTACCTCACGAGCAAAGGTGGTGTCGATAATCGACACCTCGGATCCAGAGTCAAGCATGACTACGGCCTTGGTATTGTTGATCCTGCTGCTG
ACCTTGGCTTGCTTGAAGTGTTTTCCGGGTACGTAATACTTCCAGTACCCTCTCGACTCTCCAGGCATCAGATCCAGGGTCATAGGCACTTCCGACCTCA
TTTATTCATCGGGTGCACGCAGACTCGCAACAGAGGCAACACGCTTTCTTTCATGATCACGTATATTATCAGAGGGCCCCGATCTTGCGACCGTTCCTGG
GTGTCTCGGTTGCTTGTCCACAAATGCATAGATGCAGAACGTAGAACGCTCGTCTCGTACCGGAGTCAAACCCGGCGAGCGCTCTAGTTTAACACCTTTT
CCGCCGCTTCAGGCAGAAGTCCCGGGTGTTTGCTGGGATCGAACCACTGCCGGATCAAGTTGTAGAATTCTTCCATCTGACACTTGCCGTGATCATGGAG
CTCGCCGCACCCGCGACACACGAAGAAGTATCAGTCGGACGGATGCCCCTTCTTGCCGCACTTCTGGCATGTGAGACGTTTCCAGCAGCCCAGGTCTGAA
TGCATTCTCGATCCGCAATGCGAGCAGCGTTGCCCGTCATTCGGAAAACGAGGCCGGCGATCTTGTGCGCCGGGGTCTATGGGCGGTGAGGCGGAAACAG
GCGACGTCGCGCTTTCGCCAGTCATAGTCGTGATCTCCGCCGATTACGATCCTCTTGTCGCGGCCACGTATGCTCGGTGTAGCTCTCCCTCCGATCCTGA
CTCGTCTGTGTCAGACTCACTGTCCGACACTGGTAGATGCATTGTTCGTACCGCTCGCGCGGGTGCCGACGGCTGCGGCATCGCTGCTGGCTTCGGTCGG
AACTTGCTGCCTCCTGCCGGCTTCTTGTGTCTAGACTTCGATCGCTCTCGCGGTCGTAGCACTACCTCCAGCTCTTCTGCGTCCCTCAACCGTAACAGGG
TCAGCTGGTCTGCAAACTCAGAGTCTCCTAAGATTTCGATGAAGTGCTCCACGTGCTCGCGACGAGCCTTGGAATCCCCGTCGTTGATCCTAACGCGGGC
GCGCATGCCCGCTACATTCAACCGATGTAGATACTCCAGCGGAGGTTCGTCCCCGCGCTTACGCGCGTGGTAGTACTGCCACGCTACTGACACCCCCAAT
CGACAATACTGTGACTGAAATTCCTTCGCCAAGTCTGCCCATTTCGTTCGCGTCGACCGGCTCAGTTGTCGATACCAGTTTCTGGCCGGGCCTGTGAGGA
GATCCGCGAAGGTGAGGCACTTCTCCTCATCCGACGCTTGGTCCCTCGTGAAGGCTGACTTGACTTTGTTGATCCAGGCTCGTGCGCGTTCTTCGTCGTG
GTCCTTCCCAGTGAAATCCTTCAGGTCTGAGATAGCCGAGATCCTAACCCGCTGGATCGTGGCTGTTCCGGCTAGCGGTGTCGTTGATGCAGCTGTAGAG
GCTGCAGCTAGCCTCCGGGTGCCCACTGCTCCCACGTCGTCCGGGTCATACTCCCAGTTCTCGGGATGATCGTGAGATCCTACCGACTCCATGTCCACGT
CCTGTGTTCGTAGGTAAGCTGGGATCTGCCTCCTTCGCTTCGCCGTGGTTGGGTCCGTTTTTGGGACTGAAGTGAGACTCCGTTCTTGTAGGAATTGATC
CATCGCTGACTGGAAGAATCTTGCCAACGCACTCGACGACTGCGCGGGGGGGGGCTACCTCGGGCGACCTAGCTGTCGGGCTTGTCGGGGCCCGAGCCGG
CCATGTAGTTTTCGCCTGTGGTGCTGCAGCTGCTGACCGGTTCCGTAGCAGCTCGGTGCCTGCTGGGCCCAGCGGCATGCGCTTCGGTTCGGTCGAGCTG
TCCGATCCTACTTCCGACGTGGCCGACTCGTAGGTGGAAGATCCCGTATGGTACTCTGGCGTTGGTGGTTGGCCCCCTTCGCGTAATTAGGCTGGATCGG
TTCTAATGCCTCCTTCTCGCCTACGATCGGTTTCAGCTTGTTGAACAGCGCGGCCGCCGCGAGTCGGATGGTATCCAGCTCTAAACCGAAGAGGTCTTTC
GCCTCAAAGACACCGACGGCGAGACCCGCCTCCTGCGCCAGGCGCAGCAGGCCTGTGGCAGCCTCCAGCTTGTTCATCGTTAGGGACGGGGCCTGTATCG
GTCCAGTGAGTCCTTCCGGTACCTGTAGCTGCAAGATCTGCATCACGGGGTGGTCGCGTAGGAAGTCTTGCAGCACGATCCGCCGGTAGGCCACTTCCAG
CTTGGATTGCGTCCATGTCGCCTTGGTCATGCTACGATCTTCCGGCTCCGCATCCGGAGCTCTTAGTTTCTTTCGCGCTGCTCGTGTCTTCTTCTTAGAC
ATGGCTCCCTTGGTCTGCGCGGGGTTTTTGGCCGAGGATCCAACAGCTTTCGCTGCTGGGTGCTCGTCCGGCGGGTCGTGCTTCGCAGCGCGACCCGCGG
GGGTCCTCGGGAGGACCTGTGGAGGGGGTAGAGGCTTCTCCTCGAGATCAGGGTCATCCCGATCCGCCTCCGATCCGCCGGTAGAGATCCTCCTGGCACT
TTGTTGGTTCGAGGATCCATTCTTCAGCGACGCCGCCGGTGATCCTAGCTCCGTCGGCGCTTCATTTCCTGATTCGTTGCTCACATGCGCATCATCTTGG
GACTCACGGTGAAATCCCGCGTCGCCAAGAGATCCGGGCACGCGCACCATTGTGGTGGAGTGGATCCGGTGGAATTGGCAGGGATCCCACACTCACACAC
TGCGCCCAGACACCGACTAACGGAGGGGGTACTCCGATAACCGTAGGTTGCTGAGTGGCTCACCTTGTGTACCCGTCGGCGGGTTGGTTCTGCTCTCTCG
TTGACACAAGATGCGCAGCGGGTGAACTTGAATGTCCCTGGCGGGGACTTGGGGAGATGTTGGGGTAGATCCGCAGTGGGGGTTCCTTCGCGCGGGTCTG
GGTAGGTTGATCCTTGGTCTTGGCCGTAGATCTTGTGGATCCGATAAGAAATATACCGGATCCGGAGTTGCTGCCTTGTTGGGGGTGTTGTATCCTTTTC
CTTTACGTCGCTTGCCGCCTACTATTAGCGGGG