Description :
From Genome Similarity Track
Location :
Scaffold_23:142072- 146216
Transcript NameFunction/comments
Physo_132887reverse transcriptase

Sequence
4144 bases(100 bases per row)
CACGATCACGACCCTCGTGATCGTGCTGCATCAACGCACATCCGATTGCGAAGTCGGATGCGTCACACACAACGTGGAATGGACGATCTTGGTCGGCCAC
CGCCAAGATTGGCGCCTTAATCAAGCCCCGCTTGACTGCATCGAAGGTCTGCTGACACTCAGCAGTCCAAACCCACTCGGCGTCCTTCTTCAGGAGCTGT
GACAGCGGGCGTATCATGCCCGCGTAGTCCTTCACGTACTTGCACAAGTACGTGGCCAAGCCAAGGAACTGCCGCAGTTCCTTGACGTTCGACGGCGTCG
GCCACTCATTGATCACTCTAACCTTCTCAGGGTCAGGGCGGACACCGTTCTTCCCGACGAGACACCCGAGCACGGGTATCTCGCTCGCCCCGAAGATGCA
CTTCTTCAGGTTCGCATAGAGCTTGGGCTTGCGCATGAGCGCAAGCAGCTTCCGGAGATGCACGTTGTGCATCTCAACATCGCTCATCCCGTCCCCAGCC
CGGCTGTGGACGAACACATCGTCGAAGTAGCTCGGTGCGAAGTCGCGCACCGAGCGCAACAAGTGCGTCACGCACCTGTTGAAGGTTGCAGGGGCGTTCT
TCAGACCCTGCGGCATCACTAGCCACTCCCAGAGAATGCCGCTCGGCGTACTCACAGCCGTGAGAGGGATATCGCTCTCACGCATGCGGATCTGATAGAA
TCCATCGCGCAGATCAAGAGCACTGGAGATAGTGCTCCTGGCCATCGAGTCGATGATGACATCTTTTCGCGGTATCGGTGTCTGTGCCGGTATCGTCGCA
TCGTTCAGCTTGTTGTACGCATGAGCGATGCGCCAGCCGCCCTGTGGCTTCTTGACACAGAACGTCGGAGCACTGTGCGGGGATTTCGATTCCCGCACTT
GTCCAGTTTTGCGACGACTTTCGAAGAAGTCGTCGATCGCTTTGACCTGCTCTCGCGGCAGTGGCCACTGCCGCGTGACACAGTACTTCATGCCCGGCAC
GACATCAATCTCGTGCTGGATTCCCTTGTCCTCCGGAAGCTCCGCAGGAATCTCTTCCGGAAGTACGTCCGCGTACTCCCGTAAGATCTCGTAGCAGGGA
CTCGTTTTCAACGAGTCCCAGCTCTGCTCTTCAAAGCGCTCCTTCATCGACTTCGCACCGAGAGTGTCCTCGCTCTCAGTGGTGGTCTCCATGAAGAACT
GCCTCAGTTCTTCATTCTCGCTCTTCGTTCTCTCGGCGTCCGAGAGAATGCATATTTGCTCGATGCGTCCATCGTGCAAGTCACGCGCGAAGTGCTTCCA
GCTCATGACTGGAAGCGAAGTCAACTCCGACGCTTGCGTCGGAGCATTAGCGAGGGCATCTCCCTGTACCGGAACCCGGCACAGGAACGCGTCAAGACGT
TCAACGTCTCGACGTCCGGCTTCTCAGCCTCCGTCTGCCCGGCAGACATTCCTTGTAGCGTCTCGGCCCCAGGCCGAGACTTGCGCAGCGACCTTCGCAT
GCTCCATCTTCTTGTTTTGCGGAGCCCGACTCCGCTTGGTTTTTGACCTCGTCCAGGCCCAGCCGTGGACGGGTGTTCTTCTTTAGTACCGCCGGCGGGT
TCATCCCGCCGGCGAGCGACTTCAAGCCCGGCTTGGTCGCCCGGCGCTTCGTCGTGCAGCCGGGCTGCATGACAGCATGCAAGTTTTTCCGGTGCGGAAC
GATTGCAACCGTCCGCACCGCCTGCAGCGTCGGCTCCCGGAGCCGACACGCCATCTTCACCTCGACGCCTGTTATTGGCGGAGCCCTCCATTACGGAGGG
TGCGTCGGCTCCCCGAGCCGACGAATCGAATTCACCCAAGCCATCGACACCCGGAGTCGACGGCGTTACGTCACTTTGGCTCTTATTATTGGCCAGACCT
GATCCAATCAGATCCGCGTCAGCCTCCACGGCTGAGGCGTGTGACTCATCTGCGTCATCCGGGCCCCTTGAGGTCGGAGACTCTTCCTGATTCGCTGAAA
TGCGGGTGTCGATCTCCGAGATCAACACATTTTCTCCTTCAGCCGTCGGCGGCGACGCCGACGCTTCCTGCTCTTGCGAGCGTGCTCGCGCGCGCCCAGG
GCGCTCCGGGACAGCGGCATTAGGCGCAGTCTCGAGTGGGGAGTCGCGCGCACCTGTCGGTGCGTGCGTAGCAGCAACAGGGCCATCGCTCACTGTTCCG
CTGTCGCGACCGAAGCGCACGAGAGTGCGCTTCTCCCAATCGATGACCGGATCATGTCGAGCAAGCCACGGCATGCCCAATATAATGTCAAACTTATCGT
CCAGATCCAGGACGATAAAGGTGTCGACATATTCTTGATCTTCATACGTGAAGCGCACGCGTACCATGCGCTTCTCGGTCTTCACGACGGCACCCGTTGC
CAGTCGTACTTCCAACATACTTCGAGGTATCTTTAAATCCTCGAAGTCAAGCCTTGATAGACTTCGCAGTCGAACAAAGTTCTTCGACGCGCCAGAATCT
ACCAAAGCACGGAGAGAGCCGCTTGCTCTCATCGAGTTCACATTCAGGATGACAAGGTCAGGCTTGTCATCTTGGTTCTTGCAGTGAGGATGAACCTCAC
TGGGGGCTGCAGTCCTCAGTGTCGCGTGTCCAAGGTGGACACGCGGAACTGCATTACCAGTAGGGCGCCCCGCGCCTACTGGCGTCCAGCGTTTTTTGTT
TGGTTGCGATGGTGCCCGGCACCGCCGCGATAGCCACCCTGCTGGTGCACGGGGGCCGTGCACTCCCGAGCAAAGTGACCGATTCTACCGCATCGGTAGC
ATCGCACATTGTTTCCTTGCGACTGCTGGGGTCCAGCAGTTGCAGCACTCGAGAGGTCCATGGGTTCTGGGCCTCCCGTCCTCACTACCGGGCGTGGCTG
TGACCTCGGCACATGTGCATGCAGCTTAGCCTGCCGCAGGCTAAACTCCTCCTGCATTGCAAGAGTCATTGCAGCTTCGAGAGTACTCGGGTACTCACGG
AAGATATAGGTCTTCACAGGCCCATCTCTCAGCCCCTTCATGAACGTGACGACCTTGGTCGCCTCGTCGATCGGATTGGTCACAATGTTCGAGACCAAGT
ACCGTGCTCTCTGAGCGTAAGCATGGACATCATGCTTGCCCTGCTGCAGGTCGAGGAACTCCGCCCTCGACCGGAACTCGTTGTGCGGGGTTGTCTGAAC
TCCTCCTTGAAACCCTCGTACGTGCTAAAGCACGTAGGATCCGAGAGTCGGCGTCCATACGCCCAACTTCTTGCACGTCCGCCAAGACATGACATGGCGA
ACGCGACCTTCGACAACGAGTCGACGATGCGTCGAGCCGCAATGGCAGTGTCGAGTTCGACAAGCCAACAGAGGAGAGGCTCGCCCTCTCTTCCAACGTA
ATTGCTCACGCTGAGCTTCAGCGATTGCGCGCGCGGTGTCGTCCCCGACGACACCGTTGTAGACGAAGCAGCATCTTGCTGCTCCCTCATGATGAATCCC
AGAGCAACACCATGTTGCTCTGTCGGCTTTAGCGTACGCAGCATCGTAGCTACAGCCGCCTCACCAATGACTGTTAACAGTCGTTGGAGAGCTTCCCACT
CTGGGTCCGACAGATGGGGACAGTCAGCGCGTGCAACGTGAGTTGTAGGCGTAGTGGAGCTTTCCATGGACACCTCCGTATCCATGGGAAGATTCTCCGC
GTTCGTGCGCTGACGTACGAACTCAGGTAGTCGGTCGTTGGACGGACTACAAAGTGCTACCAGGTGTAATGGGCCTACTTTGGCTCACTACTTTAGCTTA
CACGTGTACGGGTGTATGTGAGGAAGCGTAGCTTAGTTTAAATTAGAGTTAATTATACTCGGGCCTCCGAGTATAGATTAATCTAAATAAACGATCCAAA
TAATGTTTTTGGGTTAAAAATGAGAACTGCTATTTTTGTTTTATGTTTCTGACTTCCTCTAAATGTAATATTCTAAGATAGGAATCTGCCAACGGCTGGT
TGGCAGAATTCCAATGTTATGCATGTCGCTCATTGGCTAAGAGATGCTGCTCTCAGCCAATAGGAATCCTAAGTCTCTATGGACCACCCGTCGTGGTGGT
CGTAAATGTATGTAGCATTTGGTGTATCTACACCAAGGTCGAGG