Description :
From Genome Similarity Track
Location :
Scaffold_15:142058- 144293
Transcript NameFunction/comments
Physo_343569alcohol dehydrogenase, putative
Physo_357828alcohol dehydrogenase, putative

Sequence
2235 bases(100 bases per row)
AGATAAACTTGTCAGTCTCATGCAGAGTAAAGTAATGAATCTTTGATGTCCTCCAATCCAAGCTCTTTCGACTTGCGAAATGTCTTCAAGGACACGGTCT
CACCGAATCAAAGGCGCACTCTTGAATTCGTCACATGGGGATGAACACGTAATAATGCATCACGTTGAAGTGCCAACCAGATCGGAGGCCTTCTTCGCGT
CAGAAGTGGCAGCCGAGCTCGCGTTTAACAGACCGCGAGCTCACTTTCCGATTGACAAGCAGCCCACAAGAATCACGATGCCTTCCTACCGCCGCATCCA
AGTGCACACGTACTCCACGGACTTTCTGAAGGCGACTGAGATTGTCGAGGAGCCCGAGCTGCCCACTGCCGGCCCTGGTAACGTGGTCGTGGAGAACCGC
TTCTTGGGCATCAACGCGACGGATGTAAACATCACCAACGGCGGCTACGGACGCACTACGCTTCCTGTGAAGTGCGGACTCGAAGCAGGTCAGTAGCTAT
ATGAAATCCACAACTTTGCTGCTCATATTGACGCCATTTGCTTTGCCTTGATAGCTGGAGTCGTCGTTGAAGTGGGTGAAGGCGTCGAGGACATCAAGGT
CGGGGACAACGTCGCCTACTCGAGTAAGTCTATCGTCTACTTTGAAACAGATACATACGCTGTGATGCTCACCAATAGCTTCCTTTACCCAGACATCGGA
GCCTTCTCGGAGTACCTGGAGGTCCCCGCCTCGAAGATCATCAAGTCACCGGAGCTGTCCCCTGCACTTGTCCCCCTCACGGTCTGTGGCGTGTCAGCTT
CCCTCGCCCTGGACAAGGCTGGCGAGATGAAGTCCAACGAGACGGTCTTCGTGTCTGCTGCAGCGGGAGCTACGGGCCAATTCGCCGTGCAGCTGGCAAG
GCTCGCAGGCAACCACGTCATCGGCGCGTGCAGCTCGGATGAAAAGGTCGAGTACCTCAAGTCTCTGGGCGTCGACCGCCCCATCAACTACAAGAAGGAG
GACCTCAACGCCGTCCTCAAGGAGGAATACCCGAATGACATCGACCTCGCATTTGAAGGAGTGGGCGGCGACATGTTCAAGGCGGTGCTGGACAACATCG
CCATCTTCGGTCGCATTATAGTCTTCGGCAACTGCTCTCACTACCATGGGGACGCCGGCACCGATCCACAGTTCGGCTACCAGCAGAACCGAAAGATGCA
GCTCCGCTCGGCGTCTCTGCGTGGCTTCCAGCGGCGCCACCACCCGAAGGACGAGCCGGAACACCTCAAGCGTCTTCTGAAGCTCGTCGAGGAGGGCAAA
CTCAAGGCCGGCATCGACCCGACCGTCTTCCAGGGCTTCGAGAGCATCCCCAAAGCTCTCGACCGGCTGTACGCGCAGCAAAACATTGGCAAACTCATCG
TTCGCCTGTAGCCGCAGGATTGAGATCGTCCAACTTGAAGTGCCAATCAAATGGCTACATTTTGCTAGTCACGCTTAGCGGGCCAAACCTGTTTGCATGT
AATACTGAAATACAGTCTATTCTGATTCGTAATCCCGACCCGGGTCTCACACGTCGCATACATCATTTCGGATCGCTCGTCAGTTCTCAATTGACACGCA
AGCGCGCAGGTCGAAGAGAGCAAGAGCTACAGAGCTTAAAGATGCCGTCCTTCCGCCGCGTGCAAGTGCACACGTGGTCCACGAACTTCTGCAAGGCCAC
CAAGATCGTCGTGGACCAGGAGCTGCCCAAGTCCTCGGCGGGCAACGTCGTGGTCAAGAACCACTTCCTGGGCATCAACGCCACGGACATCAACATCACC
AACGGCGGCTACGGCCGGACCACGCTCCCCATCAACTGCGGGCTAGAAGGAGGTCCGCAACATACTGCAAACTAAGTACATGTACTATACTGCAAGTAAA
CTAATGTCTGCAATGTGTTGATTGTGAATGCAGTGGGCGTCGTTGAGTCGGTGGGGGAAGGCGTGACCGACGTCTGGGTTGGCGAGACCGTCGCCTACCA
ACGTGAGTACGCAATTTTATTACGATTTATCGGGTTTTACTAACATTTTTGTGCTTTATTGGCGCAGATCTGGGTGCTTTTGCTGAGTACACGGAGGTTC
CGGCCGCCAAGATCGTCAAGACGCCGGAGCTGTCGCCTTCGGTGATCCCGCTCACGGTCTGCGGCGTGTCGGCTTCGCTCGCTCTGGAGAAGGCTGGCGA
GATGAAGTCCAATGAGACGGTCTTCGTGTCGGCGG