Description :
From Genome Similarity Track
Location :
Scaffold_42:142056- 144294
Transcript NameFunction/comments
g17354.t1ETK77457.1 hypothetical protein L915_16279 [Phytophthora parasitica

Sequence
2238 bases(100 bases per row)
GCGCTTCCTTGAGTGTCCGAACATTCGTCCAAGTTTCTGGCTTTGCACGAAAAAGATCGTGAAAAAATCGCGTTTGTCGTTTGCGGCGACGCTGGCGGGG
ATGGTCGCGGTGGGATTAGTTGTGCAGAATACTTCGCTTCTCCATGAGCACTTTCGGTACAGACTGCACTTTTACCTCGCCGTCGTGTGCAACTCCATGG
TCTCAACGGGGGTAATGCTTGCTGTGAGGAAGATTTACTACAAAGAGACTCGCCAAGGTCGCGAACGACGTAGCGCTGTGAATGCAATTTCCCGGGCCAG
AACAAAAGCGACTTCACCGCGTCGGAAGGCTCATCGGCCGCCTAGATATCGCTCGTTAACCTTTGGACGCGAGTATCTGGACCAGATCCCTAGCGCTGTG
ATGATTATTGTGGCTGGGGGATACGTGCACGCGGTGTTGGTATTGTGGGATGAAATCGTGAACGAAGCTTCCGTTATGGTGTTTACAGTCTTTGGACTGC
TGCTCAAGCTCTCCCTTCAAGAAGCTGCGAGGCACTATGTGCTGAAAAAGCGGGTTCAAAGTGTTCGCACCATGTGCATGCTTGTTGGGGTCCCCACTGT
GCTCATTGACACACAGACTCGAATAGTTTTGCTAGGTACGCAGTCCAACTCGTCCGTGTTTGCAGGGACGTTCGGCATGGCAATGACGGAGCTTTGTCTA
CGTGCTACAAAGGCAGCGCTCGTTGTTTGGTCAACTCGGCGTCGATCCAGAGCTTTGGAGGAGAAACTACTGGAGATTTCTGGTGGTACAGCTGCGCGAT
CACGACGAAAGTCGACAGCATCTGTGAAGTTAGAGCACGAGCTGTGGCGACGCCAGATTATTTCCTACCACACCGCAGAGCTCACCGCCGACATGTACGC
CGAGTATATCGCCATCGGTTGCTCCCAATCGATCGTCTTCTGGTGGCTCGGCCATCCCTTGTACCCCGTGCTTCGCATTGAAGGAGGCAGTTCCGTGTCT
GAGATTGAGTTCGCGCGGATTCGGTTCAACCATGTTGTCATGTTGGGGTTTCAATCCGTAGCGGAAATCTTCGTCGACTACTTCTGCATCGTCCTGGAGA
TGGCGGCCGGCATCGACTTCGACAAAATTGAAAATCTGAGCTCCTTCCTAGGAGCATTGTTCATGACACTGGCTGTCGTCAACATCAGCATCTCGAGCGG
GGTCTATCTAGGCTGATACCATGGACATTCGCTGTGAAATATAATTCCTTAGTTATACCTTTCTTGTAGTGCCAAAGCTACTGCGCTCGAGCAACTGGAA
ACATTGTCTCGCCCAAGTCTCCCGCGAAGCAATCGGGATCTTCGTTCGCACATTTTGTGGTCACTCGAACGCTCACTCCGGAAACAATTAAGACGGTCAT
CCATATAGGTACTAGTATTTGCAATCGAGTTGCTGTACATGCTTTTGCTCAGTTCGGTGCATCTACCCCAGTGCAAGCTCAGATCATCGTGGTGAGACCG
CTATTTCCAGTCAAAAGTCTATTATTGCAGTAGTAAAACGATTAATCTGGACGCTCTGCCCTTCACCAGGTTTGACGACTTACCGGGTCTCTCATGGCAT
CTCGCGCCCCCATTCTAGCGGGTTCTCGTGTGGCTCCACTTGCCGCCAGCATCTTTCCAACTTCCGTCTCCCTCAACAAACCAGTCCGAGATGCCGTCCT
GTCATACCCGACCATCGACTTCCCCCCACGACCTGAAGACAAGCAGCTCCACCACTACAGCAGCCAACTGCGACTTCATCTGCAATGGGCCCCAGCCGCC
AAGATGCAGCTTTTGATGCTTCGAAACACAATTATCTGCGTCGTCGCTGCAGGGTCCGTGAACGGCTGCTTCTACGCTGGGAACATTTTCTCGCTCAAGT
CTTCCACGAAGCAATCGCGTCCTGAATTCCTCATGGCGATGTTGGTCTGGACGATACTGTGCTACGCTACGGTCATGATTATTTCTCATCTGCCTTCGCT
CATGACCCAGCGCTTCCTCGAATGTCCACATCGCAGACCCGGTCTTTGGTTCTGTACCAAAAAGCTCATGATAAGGTCGAGTCCATACTTTGGCGTGTCG
TTAGTCGGCATGATCTCTATCGGTCTGCTCGTTCAGAACACGTCGCTCATGCACCAGTACTTCAAGTACAAAGTGCATTTCTACCTCGGAGACTTGTGCA
GCCTCGTGTTCACGGCCGGTATCACGCTTGCAGTAAGG