Description :
From Genome Similarity Track
Location :
scaffold_6:142044- 159349
Transcript NameFunction/comments
g1901.t1 ubiquitin-activating enzyme (E1), putative
g1902.t1 hypothetical protein PHYSODRAFT_554330
g1903.t1hypothetical protein
g1904.t1 actin-related protein 2/3 complex subunit, putative
g1905.t1 conserved hypothetical protein
g1906.t1 conserved hypothetical protein
g1907.t1 conserved hypothetical protein
g1908.t1 hypothetical protein PHYSODRAFT_469399
g1909.t1hypothetical protein

Sequence
17305 bases(100 bases per row)
ATGGTCAAGACGGTCGTGGGCAGCGGTCAACTCGCCGCGGCTTTCAGCGTGGGCGTGGCGGCTGCAATCGCGGCCCAATTCGTGTACCAGGCCACACTAA
AACATCGTAATGGCAGCACTCACGCTGCAAAATCCGTGACGGGGGCGCCGCGCGGGACGGACGCAACGGCGCAGGAACTGCTGGAGGAGCAGCTGTCGCG
CATCGCCGCCTTCTTCGGGCCCGAGGGATTCGCCAAGCTCAAGGACGCGTTCGTGGTGGTCGTAGGCCTGGGCGGTGTGGGGTCTCATGCCGCGCACATG
CTGGCGCGCTCGGGCGTGGGCAAGTTGCGGCTCATCGACTTTGACAACGTGACACTGTCGTCGCTGAACCGCCACGCGGTGGCCACGCGCGCCGACGTGG
GGCTGTCCAAGGTGGCTGCCATGAGGCGTCATCTGCTGGAGATCGTGCCGGACTGCGAGATCGAAGACATGTCCGTGATGTTTGAAGCGGCCAGTGCAGA
CGAGCTCCTGGAAGGTGAGGGGAGAGCTTTGGTGAAACAGTGGAGGCCTTGAGATCTGATTGAGGTGGTGCGCTTTATGGCGAACAGGCAACCCGACGTA
CGTGCTGGACTGCATTGACGATGTGAAGACCAAATGTGCGCTGTTGGAAACCGTGACGCGCAAGAAGCTCAAGGTGATCACAGCCACGGGGGCAGGTGCC
AAGGCCGATCCGACGCGTCTGCAGATCGGCGCGCTCAAGGACGCTGTCCGTACGTGATGGCTGGCGTGAAGATTGCGTTGGTTGTTTGGAGTGCTGATGT
TCTTGCGCTGTTGTGTAGGAGACCCGCTTGCGACCAAGATCCGGTACTTCCTGAAGAAGAAGGGTGTTGCGTCGTCGGATATAACGACCATTTTCTCGAG
CGAGAAGAGCGTGTGTAAGCTACTGCCTCTGGATGCCGAGCAGGCGGAGAATCCCGAGGAGTTTGGCAACGTGGACAACTTCCGCATTCGCGTGATCCCC
GTGCTGGGCACGATGCCCGCGCTTTTCGGACAGTCTATGGCGGCGTACGTGCTGTGTGATTTGGCTGGCAAGAAGATCAACCCGGAGGCGGTGGCGCGGC
TGTCCCGCGACCAGCGCAACAAGCTGTACCAGCAGTTACAGCAACGCGAGCACGTGTTGTTCCACGAGGGCCACAAGATCGAGCTGCAGAAGGACGAGGT
CGAGTTCATCTTCCAGGAGATCTGGCGGGGCCACAGCTCTGTGGGCAGAGCGAGAAACGGCGGCCACGACCGTCTGTACCTGGCTCGTTGGCGGGCGGAC
CGCCCGCTGCGCCCTGACAACGTGGTGTACCTGACGACGAAGGAGCTCGCAATTCTGGACAAGGACGGCATCGAGGGCTTCGACCCGGAAGTTGTTGCTC
GCATTGATGCACGACTGAGCCAGTTCGGCAGCTGGGCTGCTCCTGAGTAGAATTGTCCTACAAACTAGAAACCAAGCTCGTGCGTTGGTGCTGACAGCAG
CAAGTCGAGCTTGCATGTATCGCCGCTTTAGGTGAATAGACGTGATCTAAAATGGACATTTCACGGTACTACTGTGCGACATGTGCCGAGTACGTCATTC
GAATTTATCTTGGTTTTTGTATACTTTTAGCCGTTACGCCCAGTCGAGTCTCAGTTAGCAATCCCCCTCAAGCTACACACACCAAGCAGCAATCCTCCAG
CATGGCCACCGCCAAGAAAGTGACCCAGAGACTGACCGCCGAGTCCTTCAAGCAGTGGATCCAGAAGCAGGACTCCTTCCTCTTTGACTGCGATGGAGGT
GCGTGGCCCATGGGCGTTTGAGCTTTGACACGGAGGCTCACGATTTGGATACTTGTGCCAGTGCTGTGGCGTGGAGCAGCCCCGATTGAGGGCGCCGCCA
ACATGATCAACCTACTGCGCTCGCTCAACAAGCGCGTGGTGTTCGTGGTGAGCTTGATATGACGTGACTTGGGGGGTGGCGGAGATTGACACGCGAGGGG
ATGTTGTGCTTTCGTGCAGACCAACAACGCCACCAACAGCCGTGCCACCTACGTGAAGAAGCTCGGTATGTGGCGCATCGCCCTAACTTTGTTGAGATTT
CGACTAACAGGGAGAGGATCCGTTTGATGGGATACAGCTTCACAGGGCATCACTGCTGTCGAGGCCGACATCGTCACGTGAGTCGTGCATTGGTTGATGT
GCTTCATGGTTGGAGAGTATGCGTGCTGACACTGCTGTTGGACAGTTCGGCGTGGGCCACGGTGCAGTACATGAAGCAGCACAAGATTGAAGGCAAGGTG
TACATGGTGGGTGAGGTCGGCCTCAAGACGGAGTTGGAGCTGGAGGGTTACCAGGTCAGCGGTCTGGAGCACAGCGACATCAAGGGTCTCCCGCACGCCC
CGGATATTGACATGGAGACGAAGGCGGTTGTGTGCGGTCTGGACAGGTATGCCATTGGTTTAATTGGTAGTAGTAGTCTCTTGAGCTGACATGCCTTGTG
CCGTTTTTCAGGTACTTCACGTACTACAAGATGGCCTACGCCACGGCATGTGTCCGCCAGATCCCGGGCTGCCGCTTCATTGGCACCAACCCGTACGTTT
GTTTATGAATGATGCGATCAACCACGCTGAGGTTTCACTCACCCAGTTGATTCTTGATGTTTGTGTAGTGACCAGACGTTCCCGACGGATGGCGCTATTA
TCCCTGGCGGTGGCTCCCTCGTCCACATGCTGGAGTGCGCCATTGGCCAGTACGTTCGTGTTGTTTCAGCCCAATGCGTTCTTGTCGCGCTAACTCGTGT
GCCATCAATTGCGTTCTTGCAGCCCGCCTGAGGCCGTGTGCGGTAAGCCGTCGCAGGACCTGCTGCAGACCATTATCGCCACGTACAACCTGGACCCTTC
GCGCACGTGCATGGTACGAAGCTGCAATCACAACGTGGAAATAGCGCCGGGATTGACCTTGTCGTGCTTGTCTTGCTGCTAACTAGGTTGGCGACCGCCT
ATCGACGGACATTGAGTTCGGCAACGCCGGTGGCCTGAATACGCTGCTCGTCCTGACTGGAATCACGCACGAATCGGAGCTGGGCAACATCGACAACGCT
CTCCACGTGCCTGACCACTACGTCGACTCGGTTGATGTGATCAATCAACTTCACGCCAAGACTCTTGACAACTAGAGTCGCTGACCACGTGACGTGACGT
GACTTAGGACACGCATCGACAACTTCAATTGCCTGTGCTGGTTCAATAGACGCAAATCGGATCGATGTGGATGTTGCCGTACCGAATCACGGTTGCTGAA
GTTCATTCTCACGAGTACCTTACACTATGAACACCTAGACAAACTGCCTGTGAGCCTATACCGATGGTGACATATTCCCGGATGTCTTCGTCTTTAGTCG
CGGAATGGCTCCGCTACTGCCACTGTTCACAAAGGCGTCGAACATGGAGAAGCCACCGCTACTTGCAGCAGTATTGGCGCCACCTCCAGGAATGCCAAAC
CTGTTAACGTTGGTAGTCTTCTTCGGGCGAACCGGGGCCGAATTCATCCGACGCGTTGCTTTCGCTGCCGTATCTACAGTGGCGCGACTACTTGCAGTTC
GTGGAGCTGGCGACGCAGCCCTCGGTTTTACGAGAGACGATGCGATCACAGGTGACATTAAAGGAGTTGGTGTCCGAAGGAAGCGAGGCATTGGTGACTT
GGTCAACCGCTTCGTGATCTCAAGGAACTGCAGCTTTTTGGTGGGCGTCACCTCCCCGTCTACCGCTTCCCTTGGTCTCTTTCGCGTCGGCGCTCGCAGA
TTTCCCGGGGAGTCATTGTCGCTAATAAGGCCGCTGCTGTTCAAACTAATGTTCAAGTCGCCATCCTCAATGTCCTGATTCCGTCGAGGCACGTTTGGCT
CTGCTGGATCGCTCGCTAAAGCCTTCCGAAATTCTGCACGCTTCGTTGCCAATGTCTTTGTTGCTGCGTTCCTCTGGGCTTTCTTGGTCTTTTTGCCCAT
CACTTTTGGAGTGTTTATATCTTGCATCTTGTTCATCCGAGCGAGCAGCTCAGCATTTGCTAGTCGCTGCTTGATCGTCATTTTCCCACCGTTGCCTCCT
GTTTTCCTTTTTACCGTCGGTGCTACGACGTCTTCCTCTTCCTCCACCGACGCCTTTGACTTCAATTGGGGCTTTGTCTTGCCCTGTGCGCCCTTGTTTG
CTTTAGCGGTGCTGTCCGCTGATGCTGCTGGTTTAGCTCTGCCAGCCGTGGCACCCTTCTTCGGCTTAATCGCAGTCGTGGAATTCGCTACAGCCGCCAT
CAAGCTTTTATCTGCAATCGCCGCCGTAGCCTTGCCTGATTTCGCCGCCGCCGTTCGACGCTTCAAATGCTTCTTCGGGGTTGAGATTGGCAGGGGCATC
GGCTCAGGTTCGGAATCGGCTTCATCATTCTCGTCCTGTTCAGCACGAGCAGCAGCTTCAGCGACCTTCGCTTGCCGTTTGGCCTCTGCGTTCGTAAAGT
TAAAATCCAGGGGCGGCCCTCCCTTCTTCGAAAACCGCTTCTGCGGCGTCGGTCTTTTCTTCTTCGAAGGCGACGGCTGTGCTCGTTTCGGAGAACTCTG
CGTAACTGGCAGAATCAAGCTCACCATCGACGGCTCATCGTCAATATCCGAGTCGCTGTCCTTGTCCAAGGACAGCATATCCAGTAGTCCATCATCCGCC
AGCTCCAGTGGCGGGCTATCATATCCACCAAGCTCAACCTGATTCTCCTCTGAAAACGATTCGTCGTCTTCTGGCTGCACCGCTTGCGGTAAGCTAATAG
GCGTGATCCGCTTCGATGGTACAGCCTTCGTTTTCTTGGCCTGCTTCGGCTGCATCTTGGTTTTGGCCCTCTCTTTGGCCTCCTTCTCGTCCGTCTGTGA
GTCGCTGGCCGCTACCTGGTCCAGCTTCTTCTTCTTCGCCGCTTTCAACCTCTGTCTCTTCTTAAGAAGAGCTGTTTCCTTCTCAAGTTCACGTCGTAAG
GCCGCCTCCTGCTCCGTCGCCAGCTTCTTCTCCGCCTTCAGCCTCTCATTCTCCAGCTTCTTAGCCTCCGCTGTCAGCCTCTCCTCCTCTTGCTTTGCTA
CCAGCTCTTGCAGCTTCTTCTTCTGCTTCTGCTTCTCCGCCTTCAACTTCTCCTTTTCACGTCGTAGTGTCTTCTCTTGCTCAGCCGCCAGCTCGCGCTC
CTGCTCCTGTTCCTCCTCCTCCTGTTGCTCGAGCAGGCGCAGTTGGCTCTGGTACATCAGCTCCTCCTCCTCCATATCCTCCATCAACATGAACTGCTGC
CAGGTTTTCTGCAGTCGCTGGCGCCGCAGCTCGATGGCCTTCCACTACACCCCCCAAATGTTAGCGTTGCATGGGCGATATCTCAGTTTCTAACGGCACT
ACAAACCTACTTCCAAGTTGTATGCCTCCAGCAGAATCTCCTCCGGGTACAGACCGCCCACGGGGCCTGTGGCGCGGTCTGGGGCTTCCATCCGCGTGCT
CGGCTGCCAACTCCTCCTGCTCGTGCTTTAATGGCGGTCGGAATTTAAAAACAGCTGCTATGTACAATTTTCATGTGGCGTACACGTAGTTGAAGCCGTT
CTTACAGAGGGATGATAGACATGCTTCTCTCTACAAGGGCGCAGCATAATCCCTCTTTCAACTCACTTCAGTTCCAGAAAGGGAGTCAGTCGATACAAAA
AGCAAGATCAAAAACCAACATGGCAGTGGGGGGCGACGCGAATCTCTTCCAGCTCGCGGGCGGCATCTCGTGCCACGCGTGGAACAAGGACCGCTCCAAG
CTGGCGATGTGTCCCAACTCGAACGAGATCTGGATCTACTCTGGCTGCCACGCGGCCGACCCGACACAGTGGCGCAAGGAGGCGGTGCTCACGGAGCACG
ACATGCTCGTGAGCGGCCTAGACTGGTCGCCCGTGCACGACCAGCTCGTGTCCTGCTCGCACGACCGCAGCGCCTTCGTGTGGAAGTTCGAGGCCGCCTA
CCGCCAGTGGAAGCCACTTCTTGTGCTGCTGCGTATCACGCGCGCCGCCACGAACGTCAAGTGGAGCCCTGACGGTGAGTACAAGTAGAGAAAGAGGAGA
GTGCTAGCAATTGCTGACGCTGTGGTCCCATGCAGGCAATAAGTTTGCAGTGAGCAGCGGCGCCAAGTGCGTATCGGTGTGCTACTACCAGGCGGCGGAG
AACTGGTGGGTCAGCAAGATGATCAAGAAGCACAAGTCCACGTACGTTACTGCTAATGATTGTGTCAGCTTCAACTTGATATTGAGGGTGGTTATTGGCT
ATTGCAGGGTCACCGACTTGGACTGGCACCCGAACAGCCAACTGCTTGTGACCAGCAGCACGGACCTCAAGTGCCGCGTCTTTTCGGCGCACGTGAGCGA
CGTCGATGGAGCTGCTGACGCCGGCCCGTTTGAAGCTCTACCGCCGTTTGGAGAGCCGCTGGCTGAGTTTGACAATGCCAGTGCGTGGGTGAACGCTGTG
GCGTGGTCCCCCAAGGGCGACCATCTTGCGTTTGCCGGCCAGGGATCGTCAATTCACATCGTTCGCTTTGGCGCGCCTGGCGAGTTCCCGACGATCCAGG
TAGTAGAGGTTGCTGGGTCGAGCTGTGCTTGCTGTAATGTGCTGACGTTTGTTGTTGTTGCCATAGTCGATCCGGTTCTCGCACCTGCCTCTGATGCGTA
TCATGTTCCTCTCGAACTCCGCGATCGTTGGTGTGGGTTACGACTTCAACCCGCTGCTGTTTTCTCAGGATGCCAACAACTTCTGGTACGCATTAGCTGA
AACAATTGCATCTTGCTTGATCGGGGTTAATCGTTGTTTGACAAATGCGCAGGTCGTTCTCTGAATTTGTCGACAAGAAGCCTACGGAAAGCGCTGTGAA
GCGGAACGCGGGCGGCTTCAACGCTGGTAAGTGCAAGTAGTATTGTATGGACCGAACACTGAATGTATCCATGTATTAACAAACGCCGTTTCTCAACCCC
TCAGCTCGAAGCCTGTTCGAAAGCAAGGTGACGCGTGGTCAATCGTCTGATGCTACTCAGCATGATAAGAATATGCTGTGGATGTACGTTTAGCAATGTC
GTCGGGACTCGCAGTCGTCATGGTACTAATATAACATTGTCCCCCGTTTACTCATCGCAGGAAACATGAGAGCAACATCACATGCATCCAGCCGTACACG
CGTTCTGCCTCGGGAAGTGTCTCGGAATTCTCCACTTCAGGTACGGCTCCAGTAAAACTTGGTCGAGCGTTTGTTTGTGGTTACGTATCACTTATTTAAC
GTGCGCATGTGGCAACTGCTACTGTATTTCATAGCGCTTGACGGTCGTGTTGTCCTGTGGAAGCTCGGAAGCCTGAATGTGGAAATGAGCAAGCTGCGTC
TCTAAGAGGATACGTTTGCGTAGTAGCCCGACAAAGTTAAAGCTCTTCACCGTTGACGAAAACAGCAATTAAAATGCGCTAGCATCTACAGAAGGTGCAA
GCAAAGCGAGCAAGACACAACAAGATCATGAAGGCAAGCATTTCAACTTGTCTGTCGATTGGTTGCTCCTACCTACATACCCTCTTTCTCCCGTACTATA
ACAACGGCAACGACAGCTCTATTCGTACATCCGCTTGAGCCGTCTATAGTCTTGACGATATTGGTTCTCAACCATAGATGCGTGACGGAAGTCCTTCCAC
TCAGGGAACTCCGTGAGTAGAACCTTCGGGTCGAACGAAAGCAGTAGCTGGATGCCCTGGCTAACGTCATTCAGCGTGCGCGCGAGATCGATGTGGTCTG
GGTTCAAGTACGCTCGCTGCAGCTCAAGCAGCTCGTAGCTACTGCGTAGGAACAGGATCGAGTACTCGCACACCCGCTCAGTCTTCGCACGCAGCAGCAG
GTCACACGAGTCTGCCACCAGTTTGTGGATGCGCATAAATACCAAGTGGTCGTGGGCCACGATCTCCAGAGCGTCGGACAGTGTCTCGAGCGCCACGGAC
AGCGCAGAAGCAGCACTCTCCGGGTTCGTCTTAATAATCTCCTCTGCACCCACCAGCACCTTCTCCAGGTCCTGCATGCCTGGCTTCACGCCATCACTGT
CATCTGCCGCACTCGGCGGCGGAGGCAGCACACTGTCGCCTCGCCTGCAAAGCTGACAGCCGCACTTGAACCCGAACTGCTCCCACAGATTCTGCTGCCG
GTTCTCGCGACTTTGCTCGCGGGGGTACAAGTACGAAATAGTGAGCTGCTCGCCCTTGGCGATGGGCCGAGCCACTCTCACCTCGGACACGCCTCCTTCC
GGTCCGGCGTCCTCCGGTGTGAACTTGACACAGTTCGGGTTGCAGTCGTGATTGAACATGGCGTTGTACAAGAACACACCACTATCGAACGCATTGCACT
GCATGGCGAACACGTTCTGCAGCACCTGGTTGTGGGATAGCGGCAGCTCGCTGAAGTTCCGGCACAGCTCGTCGATCTGCGGGCCGAACTTGTCTCTGCC
TGCAGCCAGCAACTCCTCGGGCAGTTCACTCAGCTTCTCCGGGTACAAGTGGCCCAGATGCTCCATGATGTCGACGTAGTCCGGTCTCGACAGCACCGAC
TCCATCGTGGCTAGGAAGAACTCCGGGTCCGACGTGTCCACGTCACTCGGCCACGGGATATACACCTGCTCCACGAGCACCTGGGTGCCCGGCACGAGGT
CCTGCGTGGCCACATATCCGCGCGATCCTCCGACTCCGTCAAAGCTGGTCGCCAAGTCCACGGGCCCCACCGCCAGCGGCTTCACGTCGTCCCAAGGCTC
GTACAGACTGCGCGCGACTTGGCTCGAGGCCTCTTCCTCCTGATCCACAGCTGCTGGGCGTGCAACAGGCGCAGAGACGATGTGCACGACCTCGTGCGGC
GTCACCATCGAAGCCGATGTCTCCTCATCGCTGCTGTCGTCGTCGAAGAGCCCGAACGCAGCCTGCACCGACGCACTTGGCTTGCCACTCATGACGGTCT
GGTTGGCCCGGAACTTGACTTGCAATGATTGTCGTGTTACGTACAAACATCAATCGTATCAGAATGATTGCATTGTTATGTATCACACACCATGATTGCA
CCTCCATACAAACACCAAGTGAATCTGGGGCATACCGACTCCCTGGCTTTTGCGAGAAATGGCCGAGCACCTGGCTTCTCAGCACGAGAATGATAGCCTC
CCAGTGCGCCCAGGGCTCCCCCTTGGGCGCCGCATGCGGTTGACGCTGGGACAGAAGCGCGAAGTGGTGGACCTGGCGGCCAGCAAGAAGTTCACGCACC
GCGAGCTGGCCGAGAAGTTCCGCGTGGGGCGCACGACCATCACCAATATCTGCCGACAGGAAGAACTGATTCGATCCGAGACGGACTCAGCCGACGCTGC
CAAGAAGAAGCGCAAGACCACAAAGTGCACGTACGACCTGCGTGTGCTGGACGAGAGTCTACACAAATGGCGCATGGAGGTGAAGGTGAGCAGTCCTGAC
ACGAAGCTCACGGGCACAGTACTGCAGCACAAGGCCATGGAGCTGGCCTGTAAGATGGCCGACGACCCGTACGCGGCGCTTCCCGACAAGGTCAAGCAGG
CGCTGCACAAGTTTACGGGCTCGAACGGCTGGCTGGACGGGTACCGCACAAGGTTCGGGTCTTTCAGCAGCAAGCAGCTGCCTGGAGGAGGCGACCAGAG
CGTCATCAAGAGCGTGGACATCCAGACGAGGCTCAGAGAACTGCACCACAGCTTCATGAACGTGCAGCTCGAGGACATTTGGACGGCCAGCGAGTTCGCA
GTCATGTACAAGCCCCCCGCGCCCGTGTCTGACGGCAGTGCAACAGGGAGTAACAATGGCAGGTACACGGTTTCGCTCTTTGTCAGCGCGGCTGGAGAGA
AGTTTGATATGCAGGTTATTGGCATGGATCGCAATCCACTACTGCTGGAGGGAATCGACACCAAGGAGACGTACAAGATCCAGTATGGCTACTCCAAGAC
GGGTTGGCAGGTCGCGCAGACGACAGTGAGCATGCTCAAATCGCTGAATGCTCTCGCAAGGGAACGCAAACGCACGTTCCGCGTGGTTTTGGACTCGGCG
GTGCCCCACGTGAAGGCCGCTATGATTCTGGACTCACAGGGCGACCAACGAACGTTTTTCGTGTACGACCACCTCCAAATCTACTTCTTGCCACCGAACT
TCAAGGCCCCGCGTTTCCACCCGTGCCACCTTGGCGTGATTCAAGCGTTCAAGGCGAGGTTCCGCAGTGAAATGCTCGAGACGCTCTTCAGTAATTATCG
ACAGAGCGTGATCAGCCAGGACCCGCGCGGATTCCACCCGCAGCGTCACTTGCATACCAGAAACGTGTTTCACTGGTTCAATGTGGCTCTGTGTAGCCTG
GATAAACAGCTCATCCAGACGTGCTGGGTCCAAAGCGGTCTGCTGCCCACTCAGGCCATTGCCTCCCTCAACTTACGCGCCATATTGAGCAATACCTCGC
CCATGAGCATGACCCCCAATACCTCAACTGGTAGTGGCAGTGACAGTGGCAACGGAGGTGCAAATTCCGATGTCAATGGCATGACCCCAAATGGAGCGAG
TGGAGCTGGCTCTACAGTCGTAGCACACGCTACACAAGGAGGCCTGCTGTCGCCCGCGGTACTCTATCGCGATTTACAGTTGCAACTGACGAATATCGCC
CAGCTCGCTCCGGACTTCTTGCGCTGGATTGGCGTGAGCGATCCGAGCAATGCGCAGGCATTTGTGGAGCTGGAAGGCAATGCTTCCGTAACGGACCCCG
GCATCGATGAAGTGCAGATCATCCGCGGAGTGCTTCAAAAACATGGCTACCTGTCCACAAAAAAACTGGATGATGAAAGTCATGCCGAGGGTCCGTACGA
AACCTTTGACGACGTGGCTGATGAGCCCTGCCCAAGGCATGATGAAGTTGTGGCGTCCATTGAGATCCTCAAGAAGTACCTGAGGCTGTCACGGGACGCA
ATCCCAGACCGTGTCGACGCTGTAGTGCAGCTGAACCAAGTCAAAAAGGCGATTAATGCTGCTGCCTTTCGCGACGCCGCCATCCGGGAGGTATGAGTGA
AACCCACTTGACGGAGTGAAATGTGCGGTACTGTTTTATTCTACCTGGCATCATGCTCATCGTTCTCATTGTATTGTCACTGTTGTCGGCTCTATCTTAC
ATATGCATGGCTCTCGAATATTGGGTGCCCTAGCTAGTACACAGTCCGGATTCTGTAGTTGGGAGGCATTGCCGCCATCACGGTGTTATCGTCTAGCCGT
TGGTTCGTCTGGGTTGGCAGCGGCGACGACATCCGAGCAGGTGGGGTTGACTGAGGCAAGAGATCATCGTCAAGCGGCAGGATAGTACGTTCCGCAATGG
CCTGCTGCTCAATGCGACGTTGGCGCCGTGCGTATGCTACGAGTGTGCGCAACGCACTCACTAACCAGTCGCGGTGGCTTGAGCTCTGGGTCTCAAGATC
TAGTGTACGATCCCGGAAAACAACCGAGAAAGAGCACGCCTCGAGCACGCTGTTGGACGGGTACTTGCGGAACACAGCCGTCTGTCTACCGTCCAGCACC
TGCAGCACTTCTGCCAAGTCAACCGCTCCACTGAGCCCGCCTCTCTTGTGCTGCCACTGCAGAGTTCCGCAACAGTTGCAATGGAGTCGGGTAGCATGAG
CACCGCCACGACGCCCATACTTGAGTAGAGGGAAGAACATGTTGATTGCCTGCACGAGATACGACCGGTGCTTACCGCCAAAGCGGAAGGCCAGCTCCAC
GATCTTCCACCGCGCACCTTCGATGGTCTCGAGCTCTTCGTCTGTGAACAAATACGTTTTGCGCTTCTTGCGAAGATGCAGCGTCTCCAGCACGCGTGGG
CCGATCCTAGAGAACGCACTCTTCTTGTGTTTCTTCGCAGGGTGCACTTCTTGTGCAGGGTTAACTAGCGGCGGTGTCGGCATCGGAGACCCAACGAGCG
GAGACAACATGTCAGTTGGCTCCAGGTCGTACGCATTCGGGCACGACCCAGCTCTCCTCCGCATCGGTGCAGGCTTGGACTTGCGACGGACTCCATGAGA
CTGGGCCATGGGTGTGCTCAACTGGTCCGAGTCATCCTTCAGCTGGATCACCAGCCGCCGCACGCTCGAGGTAAGTTGATCCTGCGCTGACAGTGCAGCT
TGCTCGGCCGCGCAACTGAGAAGCCGAGTGCGTCGGCGCTGCAACAACCGGTGCTCGGCCGGGCTCAACTGTACCAGCTCGTGCTCGACCTGAGACGTCG
CCTCTTCTACCTCGCTACTGGATCTTCCTTCGTCGTGCTCGGCGTTGTTGTCATCGAGGTCGAGCTCCTCCACGTCGTGGATCTCGTCAACGTCCTCGTC
GTAGTCCTCGTCCTCATCTTGGTTGGACACCGCAGCCGTCGCGCTAGCTACCGGCTCACCCGACTCGCTCATCAGACTCTCGCTCTTGATCCTGTTCACG
AGCGTGCGCACACTCGTCGACATGTTCAGCAGGTCAAAGTCCAGCAATTCCTCCTCATCACCAAAGGCTCCACTGTCTTGTTCTGCACCCGCGTCCGCTC
CAAGTGCAACCCGCCGTTCCTCTTCCTCGAGGTCCTCCTGCTCATTATTGCCCCTTTCGTCCGCCTCCTCTTCGTCCGCCTCCTCCTTCTCCTCCTGTTC
ATCCGGTAGTAGCGCCAGCAGCGGTGCAAAGCTCGCGTGCATGACTCCGAAAGTGTCAATCTGCGTCTCGAGCGCCGCTCTCCTCGCCAGCTCCTCTTGA
CTCAACGGCCGAGCCAACGCCGCCGCCACTAGCGGCCGCGCCGGATAAAACTGGAACCGCTGGCCGTTGCCACTGCTGCTGCTGCTGTTACTGGTGCTCG
GGTCCCACATGGTCATGGTCGAGTGCGTGGGCGTGGCGCCGACGCTGCTGCGCCGCCCGTGCCGAGCCGCCGGAACCGTCGCGACGTCGGCCGCGGTCTG
TTCCTTGTCCTCATTGCTGCTGCTGCTGCCGCGCGCCTCCTCCGGGTCCGCCTGGAACAGACTTCCGCGCCGCACGATAGCCGACAGTTTGCCTAGCAGC
ACGACGCTGGACGAGCGCTCGCGGCGTCCGCCCGACCACGGCTGCATCGAAGAGGGAGAATCCGGGAGAGTGGGAGCAGCCTCCACCCCAACGCGAAATG
TGGGCCGAGGAAGAGGGAGGAGGAATGAGAAAACCGCCGTGCAGTAACAGGCTGGCACGAGAATGGCTGCAACTGGAAGCCTGCAAGATAGATAACTGCA
CTTGTGACCGGAGTGGGCGTTTGCCAAGTCAAGGAGCCGTTGCCGAGAGTAGGTGTCTTCAATGTGCAATGGCTGTAGCCATGTCCGTTTTTATCAACTC
TGCAAAGTGCTGTTCCGAGCCAGCCGCTGTGTTCGTCCACAGAAGGACGGTATCAACTCGGCAGAGGGGCAACCGAGTCGCAGCTTGGCAGGATGAAAGC
CGTTACCGGACTCCACTGGCACCTGGCGAGCGCTGCTGGCCAGAAAGCACCAAGAAGACGGCGGTCCTCGCCAGAAGTCTGGTCTCTCGCCGAGTCTCAC
GGGCTCCGATGCCCTCTATCTCCACTAGCCAGCCCTGAACTCTACTGCCCACTCCTTTCAGCCGCAATATGCTTGCGGTTTGCTGGACTCCCCAAGCCGC
TGGTCTTGCCTCATCGCTGACGTACTTGTGGTACCACTTTCCGGGTACGGTCTCCGTAACGGCCAATAGTCAACATGGTGAGTGGTGGCAAGACGCCTCG
TCGCGGCCCCACGCAGCGCCGTGGCCGTCTCCAGGGAGCAGGCGCGCTGCTGCAGAGCAGTCCCGACACTGCGTACCCGTCCTCCCGTTTGCTCGTGTGG
CACTCGCGCTTCACACACGGTGCGTCTCGCCACGAGGGCGCCGTGAGCGGCCACGCTTTCAACCAGCAGCTCGAAGTGTATCTGCCTTCCAAGGCCGGGA
AGGCCACGGCGCAGTCACTGCAATGGGAGACGGGCTTCTACTACGAGATTAAGGCGTCGGTCGGCATGTTCCTGTCACCGGCCTTTATTAAGGAGTACCT
GCAGGACGGTGGCTCCGTGTTCATGGTGGCCAAGAACGTGGCGGTGGACGCCGCGCAGTCGGCGATGCTGCTGCCTTCCGGCCAGTTGCTACTACTCGTG
GATGCAGACACGTACCAGCAATTGGGCATCGTGGGTGAGAAATATGGTAGAGCGCTGCCTGCCACGAGCAGGACGAGGCGGGGGCAGAAGTACGTCATCA
CGCTCGATTTGACGTCGTCGGCGTTTGCAGAGGAGGGGGAGAATGCGTTTAGAGATCGAGTGAGAGAGTGTTTGAGCAGCAGACTGGAGGACCTCGAGAT
GCTGCTGTGTGCTTACAACGCTCGCGGATCAGCACGTACGATCTTGTTTGGAGACGATGATACGGTGCCTCGAAAGCGCGTCGAGCTTGATGGACAAACG
ACGACGTTCAACGAGGTGTTTCTGCCCAAGTTCGACGCGTTTTATGCTGTGTTGAAGAAGAAGGGCGAGCGTGAGGATGGGGACAATGATAAGCTGCGGA
CGTCGCTGCAGGAGGCATACGACTGGCTGGGCCTTGTGGCCTGCCGGCTCACTGACTTGCTGGAGAGACAGAAGCTGGAAGAGTACGTGTCAACCTTCTC
GGGCATCCCTGATTCGTTCGAGTGCGAGCCGGATAGCGAGATCACGACTGTGCGGTGGCGTGGTCTGGTGGCCGCTCCATTTTGCTCGACTGTTGTCGAG
AAGGTGCAGCGTGCTGTGAAGAACAGGGAGGTGCCATGGGGTGCAGTCACGGTTTGGGGGTTCCCGGACGTCTTCGTGTCGTGGGTGCAGCCTGTCAAGA
CTGGCAAAGGCAGTACACGAAAGAGTGAGTCGCAGCGACGAGAGCATGGCTACCTCGGAAATGGTAGCAACAACTACACCCTGCTCATGCTTCCAAACGA
CGAGTACTTCATGCTGCAGGCACTCGGTCCACACGATGCCACCGTGTAGACGACCGAGTAAGTCGAGTATCTAGTACAGCATGGATAGCACACAGGGTTA
CAATAGAATAGAACGTTGCATCACGGTCGATCTTGGCTTTATCCGCGACTATCCGAGTAGCTAGTTAGCGAGGACGTTCTCGACGAACGCCGCAACAGTG
GACGAGTCCGACCCAGCTTCGGCTAGCGCTAGCGCCACCTTGATGTGCTTGCGAGCCGGCTTCACGTTGTTCTTCTTGCCGTGGATAAGTGCAAGCCGCA
AATTCGCCAAGAAGCAAGCAGCAGTATCACTGTTGCTGCTTAAGGCGGTGGTCGTGCTGCTCACATCGTCATCAGCATCTGCCGAGGTGATAAACTTGGT
CGCCGTCAATGAAGCAACGAGCTTCCACACGTTGATTGCAGCGTCCAAGGATTGCTGTTCTTCATAAAACCCTCCGAGCTCAATCAGGATTGGAACCAAT
CGGCTCGAAGCAGCAGCAGCAGTATCGGCAGAGACGGCAGCAACAACGTCCACGTACTTCTGAACGGCCTTTGCCGGGTTAGAGATCGATAGCAGACGTG
CTTCCAGCAGGTCAGTGTCCACCGAGTCTGTCAGAGCGCCCCTCTTCTTGCTTTCTTTAACTCGAGTCAGTCCTTCGATTGAAAACGATGTTGCTTGATC
GTGTTCTCCGAGTTTGGCATAGCAGTAGCTCGTCAGGAGCTCCAACTGAGCTGCATCATAGTCTCGCCCACTTGCGGCAATAGCAAGTGACAATCCGGTC
TGCAGCAAGCGCAGCAGATGACGAAGAACGTCATGGTGCGTTTCTCGCTTCGTTTCCAGACCAATGCGCTTGAGGATGCTTGTGCCAGCCAGAACGTATG
CCTGTGAATTCCACGGCTGGGCGCGAATTAACTTTTGTGCGTCCAAACACAGCCCCTTTACCCCGGATGGGCCAGCCTTGAACAATCCCACCAACGAGTC
CAAGAAGTTGCGATCCACCGTGTCCTTGCCAGGGGAAGGCACATTTCTGGCAGTCGAACGCAAATACTCTCCCAGGCAACTCGACACTTGAAGGTTTTGC
GAGTCGATCGTCGCTAGAGCCAGACGCATCCATAGCGAACTTGAATTCGCTCCGTCATTGGTTTGCGACAGCGCTTGAAGGCGCGTCAGGTAAGCATCTT
CAGCGCCCACAAAGCGTTCGTGGAGCTCAACCAAGTGCAGGTTCAGATAATCGCGCGTTGTGAGCGTTGAATCAGCTTGGTCAACTGAGGACAAAAGACG
CTCCTTAAACACTGCTGCAAGACCCACTGCCTTGGAGCCAAACTTGCTCATGAGCAAGCTCGCCATCGATAGACCCACAAGCGCAACGACATTACTCTCA
GCGGACTGGGCTTCATCTCGTGGAATCAACGCGTGAAGCAAATCCAGCGCCTCGCCTCCCTTCGATTGACGGTATAGTAGCTGCGCTTGCACGATACCCT
TAAGTGCTGAGGACCCACTCGTCGCGGCAATCTTTTGCAAAAGCGCTGAATCGTCAATTCCATCGCAAGATTTATCGGAGAGCTGGCCAAGCTCAGTCAC
TAGCGTATTCCATTCAAGGCCTTCTTGGTCACGAGCAGACGAAGCCGCATGGGTGTAGGACGCCAAAGCCTCGGTGTACAGTCCGAGGCGGTGCTGAGCA
ACACCTAGAGCGTGCCAAGCGCGCGCATTGAACGGGTCTCGTTCTAAATACTTCTTCAGGTAAAACATCACCTGCTCGCTATCATGCTCTGGAGCCTCCG
TTATCGACTCACCGACACTAGCTCCATAGTCCAACAATGCCGTGCTTAAGCCAAGCAGAGCATCCAGATCCAACCCGACTTGCAGTGCACAGTCGAATGC
TTCGATCGCTTTTCTCTGCTGAACCGTTGAGCTAGCTTGGCGTCGAGCCAGCATCGCATACCCATTCCACATAGATGGGTTGCTTGGGTTCACGCTCTGC
AGCTGCAGAAACGACTTCTGCGCCAACGACGCCGCTGATGGCACGGCATCAGCTTGGCTGAGGTAAAACATGCCCAAATTGGCCCATGTGGCATCGCTAC
TGCTGCCGGTTTGGACTGCTCGTGCCCAGGCAAACTGCTTCACCAGCAGACTGTCAGACACAAGTGCCAATCCATTCCAGGCCAGCGAGCACGAAGGATC
CTCCTGAAGGGCCAACTTGAAATTCGTTGACGCTTTCGCCTTTAGCTTCGAGAGTGTAGCATCTGCGTCACTGTTGGCAAGACCCTTTTCGATAGAGAAA
GCTGA