Description :
From Genome Similarity Track
Location :
Scaffold_8:142041- 145908
Transcript NameFunction/comments
Physo_129518hypothetical protein

Sequence
3867 bases(100 bases per row)
TTTGGGCGTCAGGTACACAGACTTAGGGACCGCCGTCTCTGGTGATTCTGGGGCTGGATCGGGCCGCCTGTCAGTCGTGGCGCTATACGCCAGGTTCTGC
CACTCGGTATACCTTCTCGACCCGACGGACACGAAACCCGGTTTGCGAGGATCGTGATCCCCAGTTAACCACATGCCCACCTGATCGTGGTGTTGTAGGC
AGACCGGCGTTTCTCCAATGTTGGTGATCTGCAAGTATCGCGTCTTCCCCAGTCCAGCGGCCAACGTACGTACCCACTACTTGCCTCTTGTGAGCCATAG
TTGTTCGGAGTCAGCGAGTTGTATGCGTTGCGGTAGCTCGACCGTCTCGCCCGCTGCTAACGACACCCATTGACCAATCGTCATCGCCCGCGCCCGGTCA
CTGAAGATCTGTCGCCGTCCATGTAGCTGGATCCGGATCTCGTCCGGTAGGCACATCGATCCGTCTCCGAGATCTAGGCGGATCCCGGCTGGTACCATGA
AATCCATGCCCTGGATTGCTTGATAGTCTGGTGGCAGATCGTCGCCCACCCACACGTCGTAATAGTACACCAGGTTTCCGACTAACGTGAGCTTAATCCT
TGTTCTCCCAGTCGCCACGTACAGCTTCTCTCCTATGCCGAGACACTCTTGACGCTGACTTGTATGTACATAACATCCTACCTCACGAGCAAAGGTGGTG
TCGATAATCGACACCTCGGATCCAGAGTCAAGCATGACTACGGCCTTGGTATTGTTGATCCTGCTGCTGACCTTGGCTTGCTTGAAGTGTTTTCCGGGTA
CGTAATACTTCCAGTACCCTCTCGACTCTCCAGGCATCAGATCCAGGGTCATAGGCACTTCCGACCTCATTTATTCATCGGGTGCACGCAGACTCGCAAC
AGAGGCAACACGCTTTCTTTCATGATCACGTATATTATCAGAGGGCCCCGATCTTGCGACCGTTCCTGGGTGTCTCGGTTGCTTGTCCACAAATGCATAG
ATGCAGAACGTAGAACGCTCGTCTCGTACCGGAGTCAAACCCGGCGAGCGCTCTAGTTTAACACCTTTTCCGCCGCTTCAGGCAGAAGTCCCGGGTGTTT
GCTGGGATCGAACCACTGCCGGATCAAGTTGTAGAATTCTTCCATCTGACACTTGCCGTGATCATGGAGCTCGCCGCACCCGCGACACACGAAGAAGTAT
CAGTCGGACGGATGCCCCTTCTTGCCGCACTTCTGGCATGTGAGACGTTTCCAGCAGCCCAGGTCTGAATGCATTCTCGATCCGCAATGCGAGCAGCGTT
GCCCGTCATTCGGAAAACGAGGCCGGCGATCTTGTGCGCCGGGGTCTATGGGCGGTGAGGCGGAAACAGGCGACGTCGCGCTTTCGCCAGTCATAGTCGT
GATCTCCGCCGATTACGATCCTCTTGTCGCGGCCACGTATGCTCGGTGTAGCTCTCCCTCCGATCCTGACTCGTCTGTGTCAGACTCACTGTCCGACACT
GGTAGATGCATTGTTCGTACCGCTCGCGCGGGTGCCGACGGCTGCGGCATCGCTGCTGGCTTCGGTCGGAACTTGCTGCCTCCTGCCGGCTTCTTGTGTC
TAGACTTCGATCGCTCTCGCGGTCGTAGCACTACCTCCAGCTCTTCTGCGTCCCTCAACCGTAACAGGGTCAGCTGGTCTGCAAACTCAGAGTCTCCTAA
GATTTCGATGAAGTGCTCCACGTGCTCGCGACGAGCCTTGGAATCCCCGTCGTTGATCCTAACGCGGGCGCGCATGCCCGCTACATTCAACCGATGTAGA
TACTCCAGCGGAGGTTCGTCCCCGCGCTTACGCGCGTGGTAGTACTGCCACGCTACTGACACCCCCAATCGACAATACTGTGACTGAAATTCCTTCGCCA
AGTCTGCCCATTTCGTTCGCGTCGACCGGCTCAGTTGTCGATACCAGTTTCTGGCCGGGCCTGTGAGGAGATCCGCGAAGGTGAGGCACTTCTCCTCATC
CGACGCTTGGTCCCTCGTGAAGGCTGACTTGACTTTGTTGATCCAGGCTCGTGCGCGTTCTTCGTCGTGGTCCTTCCCAGTGAAATCCTTCAGGTCTGAG
ATAGCCGAGATCCTAACCCGCTGGATCGTGGCTGTTCCGGCTAGCGGTGTCGTTGATGCAGCTGTAGAGGCTGCAGCTAGCCTCCGGGTGCCCACTGCTC
CCACGTCGTCCGGGTCATACTCCCAGTTCTCGGGATGATCGTGAGATCCTACCGACTCCATGTCCACGTCCTGTGTTCGTAGGTAAGCTGGGATCTGCCT
CCTTCGCTTCGCCGTGGTTGGGTCCGTTTTTGGGACTGAAGTGAGACTCCGTTCTTGTAGGAATTGATCCATCGCTGACTGGAAGAATCTTGCCAACGCA
CTCGACGACTGCGCGGGGGGGGGCTACCTCGGGCGACCTAGCTGTCGGGCTTGTCGGGGCCCGAGCCGGCCATGTAGTTTTCGCCTGTGGTGCTGCAGCT
GCTGACCGGTTCCGTAGCAGCTCGGTGCCTGCTGGGCCCAGCGGCATGCGCTTCGGTTCGGTCGAGCTGTCCGATCCTACTTCCGACGTGGCCGACTCGT
AGGTGGAAGATCCCGTATGGTACTCTGGCGTTGGTGGTTGGCCCCCTTCGCGTAATTAGGCTGGATCGGTTCTAATGCCTCCTTCTCGCCTACGATCGGT
TTCAGCTTGTTGAACAGCGCGGCCGCCGCGAGTCGGATGGTATCCAGCTCTAAACCGAAGAGGTCTTTCGCCTCAAAGACACCGACGGCGAGACCCGCCT
CCTGCGCCAGGCGCAGCAGGCCTGTGGCAGCCTCCAGCTTGTTCATCGTTAGGGACGGGGCCTGTATCGGTCCAGTGAGTCCTTCCGGTACCTGTAGCTG
CAAGATCTGCATCACGGGGTGGTCGCGTAGGAAGTCTTGCAGCACGATCCGCCGGTAGGCCACTTCCAGCTTGGATTGCGTCCATGTCGCCTTGGTCATG
CTACGATCTTCCGGCTCCGCATCCGGAGCTCTTAGTTTCTTTCGCGCTGCTCGTGTCTTCTTCTTAGACATGGCTCCCTTGGTCTGCGCGGGGTTTTTGG
CCGAGGATCCAACAGCTTTCGCTGCTGGGTGCTCGTCCGGCGGGTCGTGCTTCGCAGCGCGACCCGCGGGGGTCCTCGGGAGGACCTGTGGAGGGGGTAG
AGGCTTCTCCTCGAGATCAGGGTCATCCCGATCCGCCTCCGATCCGCCGGTAGAGATCCTCCTGGCACTTTGTTGGTTCGAGGATCCATTCTTCAGCGAC
GCCGCCGGTGATCCTAGCTCCGTCGGCGCTTCATTTCCTGATTCGTTGCTCACATGCGCATCATCTTGGGACTCACGGTGAAATCCCGCGTCGCCAAGAG
ATCCGGGCACGCGCACCATTGTGGTGGAGTGGATCCGGTGGAATTGGCAGGGATCCCACACTCACACACTGCGCCCAGACACCGACTAACGGAGGGGGTA
CTCCGATAACCGTAGGTTGCTGAGTGGCTCACCTTGTGTACCCGTCGGCGGGTTGGTTCTGCTCTCTCGTTGACACAAGATGCGCAGCGGGTGAACTTGA
ATGTCCCTGGCGGGGACTTGGGGAGATGTTGGGGTAGATCCGCAGTGGGGGTTCCTTCGCGCGGGTCTGGGTAGGTTGATCCTTGGTCTTGGCCGTAGAT
CTTGTGGATCCGATAAGAAATATACCGGATCCGGAGTTGCTGCCTTGTTGGGGGTGTTGTATCCTTTTCCTTTACGTCGCTTGCCGCCTACTATTAGCGG
GGGAGCTGGAGGGGCGAGGGCCGAAGGGCGCGAGCTGCTGACTAAGCTATCCAGCAGTCTGCCACGT