Description :
From Genome Similarity Track
Location :
Scaffold_18:14204- 17094
Transcript NameFunction/comments
Phyci_216776Hypothetical protein
Phyci_174633Hypothetical protein
Phyci_216656Hypothetical protein

Sequence
2890 bases(100 bases per row)
AACTACGCGACTTGGTGATGCGCTACGCCGATGTATTTCGGCTGCGGTTGGGCCGCGACGAACCTGCTGAGGTTGAGCCACTGGAGGTGCGGCTAGTGCC
AGGCGCAGAACCCTACCGAAGAGGTGTGCGCCGGTACCCTGAGGCACAATGGCAATTTTTGCGAGACTATGTACGCGAGTTGGAGGCTGCAGGCCTGGTC
GAGCGGAACAATCGCAGTCGATGGTCTTGTCCTGCATTGCCTGTCGCTAAGCAAGGCACGAATGAGTTCCGAATTACAATCGACTATCGGTCTGTCAACA
ATCTGACTATTCCGGTTGCTGGAGCCGCGCCAAATCTAACTGTAGTGATGGAGGCAGTGCGCATTGCCTATGGCtttggaacctttgacttccactaggg
cttctggcagatgctgttgcaccccaacagccgtgaaatgttccgttttgataccgaggacgcggtgtttacccccacgcgcgtgcggcaagctgctagt
gattcggcggtccatttacaggcgcaaatgaatggtgttgaaggagttgctgttttaaaggatcctcatgtggatcgacgatgtactgctttttgcgaga
acaccagggacctttttagacaacctcgagcggttcttctcgatcttgcgggaatgccggttgaagttgaacgctaagaaatacaggcgtgtgaagtggt
atggaaaagtaattgacgcagaaggggtgacgcatgattctgagaggctagcagtgctaaggcaaataccgttgcctcctacaggagctgcattgcaaca
tttcctttgcgccatgaactgattacgtgaCTCGATGACAGATTTCTCCAGGACGGTTGCCCCTCTGCAGGAGAAGCTAGAACGCGTGATGCATGAGCGT
GGTAGACGCAAGTCACAGCTTAGTGGGACCACTCTGGTGTGGGCCGGAGACGAGCAAGAGGCCTTCAGGGCGACACTGGAAATGCTGGAGCGATCGTGTA
AGCTCATTTTCCAGGACAAAGGAGCCACCGTCTGCATGTTCACGGACGCATCGCACGCTGGATGGGCCTTGGCAGTCACTCAAGTCTGCAACTGGCAAGA
AGGCGTTCCTGTTGCGCAACAGGCGCATGAGCTATTGATTTGTCGAGGTGGTCTATTCAAGAAGGCCCAACTTAACTGGTCGATTGTGGAGAATGAAGGC
CACCCGATAATGAAAGCCTGCGGAGACCTAGACTACATACTCAGACGGGAGAAAGGTTTCCACATCTACTGCGATCATTCAAATCTGATCAAGCTATTTG
CACCGGACACGGAGGTGAAGGCTCACGTAAAGGGAAAACTACAGCGGTGGGTACTGAAATTAGCTACGTGATCCACCACATCGCTGGTGAAAACAATCTC
TGGGCGGATGTCATATCTCGGTGGGGGCAGCCTAAGGCAGCTGATGCAAGCGCACATCTGGTTGTCAAACAAATGAATCTGCGGTCTGCTCAACCAGTCT
CGGAGCTCCGCCCGCTGCAAGATGGACAGTTTAAGTGGCCCCCACGCAGCGAAATTGTCCAGGCGCAGCAACAGCACCACGATGAAGCACCTGCTGGTGC
CACGCAGAGGGATGGGGCAATCATggtcgacgataagttgtggatacctaggaattccaagagtctgacaaagcgtctgcttgtggttgcacactgtggt
atccagggtcaccgtggTGTACACGTGATGGTGGAGCTTCTCAATCGACACTTTGCTCTGGCGAACCTGCGCCAGACTGTCACCCGTTTCATCAACTATT
GCCTGCTGTACAAGCATCTCAACGGCGGACTGGTAGTGCAGCGTGACTGGACTGTTGGCCGGCCCGTGGCCAAGCGGAACGAGTGTTTGCACGTAGCCTA
TCTCTACCTGGGTGAGACCTACGGCGATGCGAAATATGTGcttgtattgaaggacgagctcacgcacttctgtgagctcgtggcgaccgacgcagcagat
agtaacatggcagttgctgccattctcgattggaacaagcgattcggtgtgccagacacttgggtttctgataatggctcccattttaaaagtcaggtaa
tggctttgttggccgagcacctcggcacctctcagcggtttgtaccagtgtacactccatggatcaacgggactatttagcggctgaaccgcgacatttt
gcttgtattgcggattatgttattggagtgtcgtctcgacacgcgcaactggctgcacctaatgccaattgtccaagccaacttgaaccacacgccagtg
ctttcgctaggtaacagcgccccagtggaactgtttacgggactccctgcccaGCCCGCACTTGAAACCCTGGCAGCCCCTAGCGAACGGGTGCTCCGAA
ACTTGCCGATGGAAAAGGAGGAGCCGCGCGAGGCGGTTGCCAAACTTCGGCACAGCCTCCATGGGCTGCACCGTGTGGTCCGAGACCGCCGTGAACGCCA
GCGCCTGGCAGCAATGGCCCGCTCGAAGGGCACTGTGTGCaactttaccgagggagactatgttctctggtcgcgcgtcgaccatcgtctgcagggcagc
aagttactcgtgcgctgggtcgggccttccaggtggttaaagctcttccccactcctttctcatccgccacatactcactggagccgagtatgatgtgca
tggctctcgcttgaagttctaccacgaccccgatctcgatgagatagcagagatccgtgagcacgtgtcacttcagggcatTGTGCTTGAAGTTCGACAG
ATCGTTGATCACAGAGTGAATACAACGACTGGCGAGCTCGAGTCGTTGGTCGCTTGGCGCGGGCTGGAGACATTGAGAATTCCTGGGAAC