Description :
From Genome Similarity Track
Location :
Scaffold_37:142009- 143883
Transcript NameFunction/comments
g9258.t1hypothetical protein

Sequence
1874 bases(100 bases per row)
GAAGGAACGCTTCGACGAGCAAGGCTGGGACTCGCTCAAGGCGAGCCCCTTTTACAAGGTCTTGCGTGAGTACAAGGATGTACTCCCGGACGACATTCCT
GCGGAGTTACCGCAGGACAAGGGTGTTCAGCACGAGATTGATCTCGTGCCGGGAACGAAGTACTGCGTCACGCGACAGTGGCGCCGCGTGAGCAAGTCAA
GGCAATCGACGACTTCTTTGAAAGTCGTCGCAATGCAGGACAAGTGCGGGAATCGAAGTCCCCGCACAGCGCGCCTACGTTCTGTGTGAAGAAACCACAG
GGCGGGTGGCGCATCGTTCATGCTTACAACAAGCTGAACGATGCGACGGTACCGGCGCAGACGCCGATACCACGAAAAGATGTGATCATCGATTCGATGA
CCTCAAGTACTATCTTCAGTACTCTGGATCTGAGAGACGGGTTCTATCAGATCCTCATGCGTGAGAGTGATATCCCTCTCACGGCGGTAAGCACTCCGAG
CGGCATGCTCTGGGAGTGGCTCGTGATGCCGCAGGGGCTGAAGAACGCCCCAGCGACGTTCAACAGGTGCGTCACGCACTTGTTGCGCTCGGTGCGCGAC
TTCGCACCGAGCTATTTCGACGACGTGTTCATTCACAGCCGGGCTGTGAATGGGAAATCGGGTGTGGAGATGCATACAGAGCATCTCCGCAAGTTGCTTG
AGCTCATGCGAAAGCACAAGCTCTATGCGAACCTGAAGAAGTGTATCTTCGGGGCGACCGAGATACCCGTACTTGGGTGTCTCGTGGGGAAGAACGGCGT
ACGCCCTGACCCAGGAAAGGTCAGAGTGATCAATGAATGGCCTACGCCTTCAAACGTAAAGGAACTGCGGCAGTTCCTTGGACTCGCCACGTACTTGTGC
AAGTACGTGAGCAACTACGCGGGCAAGATTCGCCCGCTGTCGCAGCTCTTAAAGAAAGAGGCTGCATGGGAATGGACTGCTGATTGTCAGCAGGCCTTTG
AAGCAGTCAAGCAGGGCTTGGCTGAGGCGCCGATCTTGGCGGTGGCCGACCAAGATCGCCCATTCCACGGGGTGTGCGATGCATCCGATTTCGCGATCGG
ATGCGCACTGATGCAACTCGATCACGAAGGTCGTGATCGCGTGGTTTACTACCAATCGCGTCAGCTGAAGCCAGCTGAGCGCAATTACCCGGTACATGAC
AAGGAACTCCTTGCCATGAAGTATGCACTCGCAAAGTTTCGAGTGTATCTACTTGGGAGTAGACCATTCGTGGTTTACACCGACCACGCATCGTTGCGTA
CGGCGATCAAGTCGCCGCACATATCACAAAGAATGGCACGGTGGCTGTCATTCTTTGCGGAATACAATTTCCAGGTTGAGTACAAACCTGGAATGTTGAA
TGTCGTGGCCGACGCGCTTTCGCGTCGACCAGATTATGCGGTGCAAGAGGCCGACGCCAACGCAGTTGGCGTCGTCAGGACGACTACACCCTCGTCATCC
TTACTGGATGACGTGAAAGCCGCATACGCACACGATGCGGATACGAAGCAATTGTTGGAGTACTTCTCCACACCTTCTGACAAGTCTCGTCAGAAGCTGG
CCAAACACCTTCGTGCCCGTGTACACCGTTATCGTGTACACAATGGTCTGCTGCTTTACAGCGCAGTCGACGACAACGCAGATCGCATTGTCGTACCGGA
TGATCATGAGCCGAAGCTCAAGATCACATACGAGTACCACGATGCCCCGACATCGGGACATCCTGGCCGTGAGAAGACATTTCTACTTCTCACTCGTGAC
TTCTACTGGAGTCACCAGTACAAGTGGGTACGCAAGTACGTTCGTGCTTGCGAGGTATGCCAGCGCGTGAAGCC