Description :
From Genome Similarity Track
Location :
Scaffold_3768:1420- 2619
Transcript NameFunction/comments
Pytiw_DAOMBR242034maker-piw_contig_3768-snap-gene-0.0Conserved gene of unknown function
Pytiw_DAOMBR242034maker-piw_contig_3768-snap-gene-0.1Gene of unknown function
Pytiw_DAOMBR242034maker-piw_contig_3768-snap-gene-0.2Conserved gene of unknown function

Sequence
1199 bases(100 bases per row)
CACGGCTCACACGGTGGTGCAGTGCCAAAACGCGCCTGTAGTTCGTTTATGAGAGCTGGAGCTGTTGGTGGCGTATGGCGCCGGGCGATGTGGGAGCGTG
GCAGGCTCAGTCGGTCATCTCTGTTGTCTGGTGTCGCTTCATCGAGGGCCCACTGGTCGAGGAGGCGTGTCCACGCAACCTGAGCCCGGCCACACGTCCA
CATGATGTGGGCAAGGTCTTCCTTGACAAGACCGCAACCCGCACCGAGTGGACAGTGGTTGGTGACCGCTCGACCGACGTGGAAGAGATCAAGATACCAC
TGTGAGAGACGGTAGATCACCCATGCATGGTAGGCCTTAGTACAGTGGCGTTGTTACCAAATGCTGCGGCCCGTTCGGTTCAGCATCTGCTGATCTCATT
CACTTCGGTCACTGGCAGACTTCATTCAGTCAACTAGTGCTATGCGTCGATGTAGAGCGACCTTGCGCAGGAGGGATTTCCGCTGGAGGTCTATAGTCTT
CAAGACTGTTTTGGGGTTGGACTCCGTGGGGATGTGCCACGGATGGCTAGTGAACAGTGGGTGGGAGATGAACGCAAGGCCGTGCTTGTACTGAGTGATC
GTAGCATCTTTGCGTTTGCTGCAGAAATGGAGGCGTTGCTGTGGTTGAGCATCCGCCAGCACAGGGTATTGGGAGTCTTCTCGAAGGTGGTGAAGTTCAA
GTTACCGTGAGCAGTAAGCGTGGGCCCCAGCGCCGCCCCTTTCCCGTTCTCCAAGTGTAGTGCCGCATTATAGGAGGGGTATTCTGCATGACCAGCTCTG
GGTACAGGCATATTGCTTCGCCGACTGCTAGCTGGGGTGAGTAGAGCACTATGCTCATTATCCAGGAGAGCAGCTTCGCGCGTCGCCGTGTGGTTCAGTT
CAGCCCTTGAAGTGGCGCGTTGAAACGCCATTGCGCCCCTGCGATTCGCGTGATGCTGAGTTGCGCGAGCGTGCAGTCTTGTATGAACGGGTGCTGCCGG
CGCTTGAGGAGCATGCCCTTCGCGTCAATGACCCACGCGTTACAGTTACAGTGGAAGACAGGCCAGAAGTTCTTCATCTGCTCGGAGACTTTAGTTTCTG
GGTGGATCCATCTCCCGCGGATCTTGAGTCGAGTCCAGCCATCGCGGTCCGCGCCGCGGGGACAGACGATCGTACTATGTCCTAAATGCTAAATGCTCG