Description :
From Genome Similarity Track
Location :
Scaffold_573:142- 3663
Sequence
3521 bases(100 bases per row)
AGTGATGACGACATTGCCCGCAACGTCGACTGCGCATCCCAACCATGAACGAGGTAGAACGGCGTTTCCTTCCTCGTAGTGTCTTGAGAAGTATTAATAG
CAAATACTAGCTTCTCCGCGATTTCGTCCCAATCTTGCTGTAGAGGGTCTTCCGCGTACACCCGTACGGATCTCATCACTGACTTCACCGAGCGTTCCTG
CTGTCCATTAGCCTGTGGCCTATAGCTCAAAGTCGCTCTTGATCTTGACTGCATCATCTCTGCGAACGCTTGGAACACCTCGCTCATGAAGCGTGGGTCG
CGGTCATGCCGTATTAATGATGGGCTCCGAACCGTCGGTACACACATTCTTCGAACACTTGGGCAACACTCAGTGCAGTCGTATCTGACATAGCCTTGAC
AATAACGAATCCCGTGAACGAGCACTGAAATAGGAGCAACGCCGTGTTGCCCCTGCGAGATTTCGGTAGTGGGATCACAAAATCCCTCGAGACGATCTGG
AAAGGTCGTTCGGCGAGTACGTTGCCAGGTGAGTATCCACGAAGCTGCGGACGGCTTTTACTCGAGCTGCAATCTGGACATGACTTCACATGCTTCTCCA
CGTCAGCGTACAAGCCGATCCAATAATAATCGGACTTAACGCGATGGAACGTTCTCACCACACCTTGATGTCCTCCTTCCAGCGAGTCGTGACAGTTCTG
CAAGACCTCTTGAATCATCGTTGTCGGTACCACAAGCCGCAGCTTTGGTCTCCTCTTGCCAACCGTGGTCGTACCGACGATTTCAATCCAATATAGTGAA
GCACGCCGTCTTCTGACAACACGAACCGGTCAGCGTACTTCCAGGCATCTCGAGCTTCTTGTAACTCAGCTCTTGTGCTTGGCCCTGAAGCACCTTCTGA
TGTTAAACCACTTCTGCTCCTCGTCTTGTGCAACTAGTATTCGTCTGCGTCGCTCCCGCTGTATCGCTACCGGGTCACATCTACCGCATCGGGAAATGCC
GCTGGTACAGTCTGTGAGGATGGTCTGGCAAATCTTCGCCGACTGAATCTTCGGTGGACGTCTCTCGTCGTTCTTCATTCTGCTCTTGAGCCTTTGAGAC
ATCCTCCGAGTGTTCATCTGCAAACCTGACGCGTTTCTTGGCTTTCGTCTGTCGCCGAGTCATCACTGCCATATTACCATAATCGCACTTTGGTGAGCTG
TAATCAACCACGAAATTTTCGAAAGTTTTCCACTTTGAAGACTCGCTGCCTGACAGTACATGTACTTGACGCTCTGCTCCTTGTGACGAAACATCTACCG
AGTCTTCATCCGGCTCGTAGATCATTTCCTGGATGTGGTTCAGCGATGCCAATTCCGACTTGCGAGATTCAGCCAAGATTACCCGACTGACCTTCGATTC
CAGCGCTTCAGTGGCTAACGAATCCGCGGCCGCGTTGTATTCTCGTACAACGTGAAGATATTTAACTGATCGAAGCTTGGCCGTGAGTTCCTTGTGAGTA
TTCAGCAGCGCTAGCAACGTTTCCTTCCTGCATGCGATCACCCCTAGTGATTGTTGAATCGCGAGCCTTGAGTCACCAACGATGACTAAATCCTTGGCAC
CGTGCGCAATAGCAGCCTTGACACCGTTTATCATACCTTTATACTCTGCCTCATTCACCGTGGTAGCTGAGAGGTAAGCGTTTGCAGCAATCACTACCTT
CCACTCAGGAAGGCTCCACAGCACCCATGAACAACTCCCGTAGCCACCGTACTTCTCTGTCTTCGCTGATCCGTCAAAAGACATGACGAATCCGCTGTAA
TTACGGGAAAGCCTGGCGTACAGCAACGCGGGGTCCATTCGAATAGTCGGGGAACCCTTGTGTGGAGGTGCCACCGGCGCGAGCGAGTCTTCCAGGTCGA
CGAAGCTCGTGATGCTTGACTGCAGTAGCTGCGCGAAGGCGACATCCTTCTCCTTCCCGCGCTGCACCTTCAGGTGCCACTGCGATAGCAGCACTGCGAA
CTGAACCGCGCGTCCGAAGAGAGACTTCGACTTATGCACCCACTCTAACGTCGAGAATCGTGTATAGACATGTAGCGTCTTTCCTGCCAGCTGGACGTAA
CAGATCTTCAACAGCAGAAGTAACGCCAAAACTTCCTTCTCAGCAGGATGGTAGTTCATCTCGGCCTCCTTGAGCACCCGACCGAGGAACCGTACGGGGT
GTAACTTGCCTTCATGTTCTTGCATTAGCGTAGTGCTCAACGCCCATTCATTCGCAAAGAGCATGACGTGAACTTCTTTCGACCGATCGAAGTGCCTGAG
GATGGGTGAATGTGAAACACTCGTCTTCAATTTTTCAAAGGAACGACGTGCCACAGAAAGGCCACCTTCAACGACAAAGTCTTCCTCCTTGAGCTGGTAC
AGCGCCGCACCGTAGACCGCGAAGTCTTGAATGAAGCGGCTGTAGTAATTAACCGCTCCAAGAAACGACTGCATGCCCTTCTTGCTCGTTGGAAACGAAA
GCTCGGTGATGGCCGCAAGCTTCTTGGGGTCAGCTCTGATACCTTCTGGCGAAATTTTATGCGACAGAAAGTCCACCTTGGGTTGGCAGAAGATGCTCTT
GGTGAAGCTAATGCTGATCCGACACTGTGCAAATCTTGCCAGCAATCGGTCCAGCGTCGCCAGGCAGCTGTCGAAATCCTCGCCACCGAAGCAAATGTCA
TCCACAAACGACCGTCGACCAAATACAGGTACCAGCGATGATTCGTCTGATTCCCCGTTCGTAAACATGTCAGCGACGGGGCTGTTGACGAGTTGTAGTA
CAGGGTCGGTCTCTACCGGTGCTTCGCGGTCTGCCGCGAACTTCGTTTGAAACGAACCCTCGGCGCTTGGCCCACGACGTTCCTTGGCCTGTTCTTCAGC
TAAACGCATCCTCTCCGAGTATTCAAACCAACCTCCTTTAGGTTGAACGAACCACCAGAGTGCGTTGTCAATCATACGCTGATAGATCATCGGCGCGTTC
TTTAGCCCGAAGGGCATGCGTAACCACTCGAAATGTCCGAGTGCGCAGACGAACGCCGATACTTTACGCGCTCGCAAGGTCATCATGACCGCCCAGAAGC
CGCTTGCTGCATCCAGCGAGCAGAACCATAGGTAGCGATCGAGATCTGGTAACAGGTAGTCGACTAGCGGCATTGTATATTTTATGATCGCGGTGATAGC
ATTCACCATCTTGTAATCAATGCAGAGCCGGATGTCCAGCCCGTTCTTTTTCATCACAATCACGATCGGCGATGCCCATGGACTGTCTGAAAAGACGATC
AGTCCTGCACGCAATAAAGCGCGCAGCAGCTCGTACAGCTTGCCGAGAAATCGCAGCGGCACGCGTCGGGCACGCTGTTTAATTGGGGCGTGCCCCTGTG
TGTCGATATCGCATACCGCTCCGTAGGCTGGCGGCGGCAGTGCGTTACCACTAGCAATCAGGATGTGCTCGTGGTTCTTTAGCGTCGCGACTAGACGTTC
TCGGCGTTCAGTCGACAGCTC