Description :
From Genome Similarity Track
Location :
Scaffold_3409:142- 1772
Sequence
1630 bases(100 bases per row)
CAGGGCCCGGGCTCCCTCCGACCAAGGCCGGGTGGAAAGAGTGTTATCACATCTTCGATAGCGAGACGGGTTTTACCCGTCAAGGCATCTGGTGTCCACT
TGGGAACCGTTGCCAGAGGTTGCAGAGATACTGAACCTCGAGGAAATGACGGCTGAGTCTTTCCTGGCCAACCTCAAGGCTGGAGAGATCGCTGAGATGG
TACTCATGAGACCTGAGACCACTCAGGAGGAGCTGAACTCCTCCTCTGTCTTGGACGAGAACGTCCTGGAAGACATGAACAAGCAGCGTCAGGCGCGCTT
GGGTTCTGAGATTCTCAAGAACCCCAAGGATCCGGTGTATCCTTTGGTGACGGAGTATGCGGACGTGGTGAATAAACACCCACCGACCCAACTCCCACCG
GATCGAGGCGTACGGCACGAGATTGATCTCGTGCCCGGCACAAAGTATTGTGTCACGAGGCAATGGCCTCTCCCGCGCGAACAGTGCGAGGTCATTGATG
CCTTCTTCGCCGCGAAAGCGAAGGCAGGCATGGTGCGGGAGTCGAAATCCCCGCACTCGACGCCGACTCTCTGCGTTCGTAAGCCGAACGGAAAGTGGCG
TCTGGTTCACGCTTATAACAAGCTGAACAACGCAACGGTGCCGGCCCAAACACCGATCCCACGAAAGGATGTGTTGTTGAACAACATGGCCGGGAGCGTA
CTGTACAGTGCGCTGGATTTGGTAGACGGATACTACCAAATCCTGATGCGAGAGAGTGACATCCCGCTCACCGCGGTAAGCACTCCAAGCGGCATGCTTT
GGGAGTGGCTCGTCATGCCGCAGGGCTTGTCTAACGCCCCGGCGACGTTCAATCGCCTGGTGACGCAATTGTTCCGCCCTTTGCGTACCTTCGTACAGAC
GTACTTCGACGACATTTTCGTCCATAGCCGTGCCCGAGGGAGGCAAGACGGCCATGGAGGTGCATCTAGGACACCTCCCGTCGAGTGTTGGACGTGATGC
GAGCGAACAAGCTCTACGCCAACATCGACAAGTGCGTTTTCGCGTCACCAGAGATCAAAGTTCTCGGTTGCTTCGTAAGCAACGTGGGCGTTCGGGCTGA
CCCAGACAAGGTCAAGGCTATAGCATCATGGCCGACGCCCGCGATCCCAGAAGGATCTTCGAAAGTGGTTGGGCTTGGCCAACTACCTTCACAAGTACAG
TGCTGGGTACGCGGGCTTCGCTAAGCCCTTGTCGAGCCTCCTTCAGAAGGACGTCGACTGGCGCTGAGAGCAAGAGCACCAGGATGATTTTGACAGCATC
AAGGCCAGTCTCCAAGAGGCCCCTGTCCTGGCCCTGCCGGACGAGACGAAGCCGTTTAGCGTCGTCTGCGATGCCTCCGATTACGCCATCGGGTGTGCAT
TGCTGCAGGACGACACGGCTGGACAGGAACGAGTCATCTCGTTCCAGTCCCGGCAGCTCAAAGCCACCGAGCGGAACTACCCTGTCCATGACAAGGAGCT
CCTGGCAATGAAATATGCCCTTGTGAAGTTCCGTGTTCACCTTCTGGGCTCTAGGCCCTTTGTGATCTACACAGACCACGCGTCCTTGAGGACGGCGACT
AACTCGCCTCACCTCTCCCAAAGGATGTCC