Description :
From Genome Similarity Track
Location :
Scaffold_1206:142- 1469
Sequence
1327 bases(100 bases per row)
CCATGACGCTCGACACACTGACGCGGGCTCAGGCCGAGCTCAGCCACCTGCGGCTGCAGACGTCGCTCGCGCAAGCGACGCAGGACTTTCGCACGCACTT
TCAGCACGACGAGCGCCTGTTTCGCTCGCTGCCGATCGATTCTCCGGCACCCTTGGACCGCTCCGCGTCTCCAGCTGCACGCGCGGCAAAGGCACATGAG
CTGGACCTGGTGCGAGGCGAGCGCTTCAAGCAGTGCTGCAAGCGGGTGCGGGTGTGGCGAAGGCTGGCGTCCAACCCGCTGCTGCAGTACAAGAACCAGC
AGGCCGCGACGACCAAGACCGGCGCGGGCAAGAAGCGGATGCACGTCACGGTGCTCGTGGCGCTGATCGTCGACATGTACGAGCAGCACTTCCTGGCCGC
GTGTGAACGGGACCCAGCGAACCTAGACGCGCAGGAGACCTTCCCCGAGTTCGTGGCCAAGTACGTCTCGCAGCGCGCGTCCAGCCGTCGAGTGGCCGTC
GACCAGCTGCACAGCATTGTGGCGTCGGTGCTGCGAGGGGGGTCTGGCCACCGCCGCGTGCAGCTCTTCGGCTCACTCTGCGGACTCGACGACGACTTCA
ATCCGCCGGAGCGCAGCAAGGTCTTCCTTCGCGTGCTGAGCTGCCTGCACTACTGGAAGCTCGCCGAAATGGGCAAGACACGCGCCGACGACCCGTCTTG
TTCTGTCGGCACCATCGTGTTCCTCAACGTGGGCATCACGCAGCGCACGGCCGAGAAGGTGGTCGCCGAGCTCTTCCACGACGACGATCTCTGGAACTTT
TGCTTCTGGTACGCGCCGTGCCGCGAGCTCAGCGTCGCCTCCGACTGGCCGCGCGACGTGTGCGTCGACATGCAGCGGCGCGCCGTGGCACTTGCGGCCT
CGTCACGCAACGCACTGCTGAACGCGTCGCGCAAGATCGACAGCGACGCGTTCCTGGAGCTGCTCATGAGCGTCTGGACCGAGCGCGCCAAGGAGCTGTT
CGCGCTGCTGGACGCCGCGGCCGACAAGGAGGAACACGACGGTGTTGCGCGGCTCCAATCCCGACAGTTTGAGCAAGACGCGCGAGCACAGCGCCGACCG
AGCACGGAGAGCGAGCGCGAGCTGTTCGCCGAGCTCGTCGCCGAGTTCTGGAACGCCGACGTGCCATGGGCGAGCGCCAGGCTGCAGCGACGGCTTTCGA
CGCTCACGCCGGCCCGGCCTCCCACTGAACTGCAGGAGCTCTACGCGAGCTATGTGGCGGGGCTCGAGGCGCCGCAGCGTCCGTGGGAGTGGCAGCACTG
GGCTTGGGACGCCGAGTGGGAGTGGGG