Description :
From Genome Similarity Track
Location :
Scaffold_3930:142- 1204
Transcript NameFunction/comments
Pytir_DAOMBR486maker-pir_contig_3930-snap-gene-0.1ATP-binding Cassette (ABC) superfamily

Sequence
1062 bases(100 bases per row)
ACCCAAGTTCACAATTCGCAACGCGATGGCGCTGAGCCGCCCTGAGCTTCGGTTCTTTTTCGTTGGGATGCTCGGCGCCGCGATCAGTGGGTTCGCGCTG
CCAGTTGCCGCAGTGCTGATCACCGAGATGATCACGAGCATGACGTCCAAGTATGCCAAGTACGAAACGTACGGCGACAAGGCGTACCTGGACGACCTCT
CGGACGACGTGAAGCTCTACGGCGTATGCTACGTGATCGCCGCAGTCGTGATCTTCTTCGTCGCGTCTATTCAGTCGTACTGCTTCAAGTATATGTCCGA
GAAGCTCACGTCCCGCCTGCGCGACGTGCACTTTACTGCATTGTGCCGCCAGAACGTCGCGTTCTTCGACGAGGAGAAGCACGGCACTGGTGCATTGACC
GCGGACTTGTCCACAAACGCTACGAAGGTGGCACTGATCTCAGGTGACGCGCAGTCGCGGATTGTGCAGGCGGCATTCACGTTCATCGCGGCGCTGATCA
TTTCGTTCTCGATGGGCAGCTGGCTACTCACGCTGATCATGCTCGCAGTGTTCCCACTACTCATCGTCGGACACGTCATTCAAGTGCGCCAGCTGCACGG
ATCTGCGGGTCTATCGGACGAGCTCGCGGAAGTGGGTTCACACGCGTCCGAGGCACTGAGCAACATCCGTACGGTTGTGTCGCTCGGTCTGGAAGAGAGC
ATTTCGTCCAAGTTCTCTGCGCTGCTGGAGAAACCGCTGCAGAGTGGACGCCGCGAAGCCCAGCTGAACGGGTTTGCACTAGGTTTTAGCTCTTTCATCC
TCTTCGCCACGTACTCGCTCGTGTTCTGGTACGGCGGCGTGCTTGTCGACCGACGCGACATCACGTTCAAGAACTTGATGAGCACGCTGATGGCGATCCT
CATGTCGTCGGAAGGCGTTGGGAATGCGGCAACGTTCCTCGCTGACTCGCGAAATGCGACAAAAGCCGGTGGGGCGATTGTTGCGCTTCGAGACCGAGAG
CTGCTGATCGATTCGTTTGAAGAAGGCGGGGTGAAGCCATCCAAGGTCGAGGGCAAACTCGA