Description :
From Genome Similarity Track
Location :
Scaffold_317:14199- 17024
Transcript NameFunction/comments
Pytap_DAOMBR444maker-pag1_scaffold_317-snap-gene-0.13Rap guanine nucleotide exchange factor (GEF) 4
Pytap_DAOMBR444maker-pag1_scaffold_317-fgenesh-gene-0.5SFT2
Pytap_DAOMBR444maker-pag1_scaffold_317-snap-gene-0.9Phospholipid-transporting ATPase

Sequence
2825 bases(100 bases per row)
GGACTGGCGTTTTGGCGGAGACGCCTGCTTTGGTTGCAGTGTCTCTGGCGTCGCGTTGGTCTCGTCAACCTCCGGGATGATGTGGCGTTGCGACCAGCCC
ACTGCCTGCGTGCGCGTCATCCGGCGCTGGGGCTGCgTGGGTCCAGAGTCACCGCCATCACCGCCAGTCACGACGCTAAGCAGCGGCACCACGTCGCTCT
TACGGCGCCGACGCCCTGGAGCCGCGTGCCCCTGCAtgTCGCcTCCGAGTATCGCATCTCACCAAGAGAGTGAAGCCATTTATGGAGGACGGGTATGTTC
GTATCGGCTTCTGTTACAAaCATGCCCACTGTCACTCTCACGAGGCGCGCATCTCGTCCACATCACGACGGACTCGATCGCTGCCGCCATGTTCCTGCCG
TTCCGCAACCTCACCAACCGCCAGAGGTGCGTGCTGGCGATGCGCTTTGCTGCCTACTATATctCATCAATGCGCTTACACCTCTAGTGCTGGCTACGGC
GTTCTTTGCATTTTCTTCATCGCCGGGATCAAGTGGCTGGATGctAACATGCCAGTGGTCGATCCGTTCTCAGCCCAGCATGACAAaCTCGTAAGTTGGC
CaTGATGGATGGACGAGCTAGCGTTGATGTAtCTTTTTATCATGTGTTTCTAGGCCTGGAGCGACATGGATGAGAAGGCGAAGAAGACTGCGAAATGAGA
GCAGGAGGGATAAAGAGGGATAATTTATGTAAGTGACGGTGCAAGATAGCgAGaCAcTCGCAAAGAGAAGACGGTTGCTTCCATACCGTCACCGTTTATC
GCAGTAGGCGGAGAAACaCTTGTATCATCTGGCGAGCTGCCTTCATGAAGAGGGCCCCGAAAGCTATGCACCAAGTAAGCTAAGTAACAACCACCATGAA
GAGTCGAGAGGATCTGTTCTCTACCTTTtgAGACTGGCATTGCCACCAGGAAACGCGGACAAGGCGAAGATGCCCAAGGTTATAAGCTTACAAAACAACA
CGTCAGCATGCGATGGAAGCTCAAACGCGCCACGTAGCTGCTCTGCACACACCTGACAAACGGAGCTGACGACGACCATGATGTAGCTCCCCAAAACAAG
gCaGCTGTACAGCGTTGAGCCTGAAAGCGgTAAGTCAAGCAAAAGtGCTAGTGTAGgACGCATcTCAATAGCGTCAGTTGTTGATCcGTACcAAgTgTAA
GGAAgTAgACAGtCGTCAGCACGATGTtCTTGGGCTGCAGCAATTCCTTTGTGTACGTCGCTGGtCCCTTCAGCATtGCAAAGGCACCCATTGCGCACAT
GCTTCCcAAGGTGAAACTGAGGGCGAACTTCGACGGACGGATCATAATCTAAAAGGACAGGCAATCACTTTTAGTcaaaTGTCAtaCCCAaTTCCCAACT
TACATTCGCAACCGTACCAGAGGGAGGAAGATAGAGGACATGCCGAAGAACATCAGCGCCATCAGCGCCAGTCCCACGAAGTATTTGAAGCGTGTGTTCC
TATGTTGGATcGAGATTGTCAGCAACCATGACACAAAACAACTCGTCAGGTCAGCGATGCAGCTCACCAGCTCATCGACGGAAGCATGGAGTTATTTTTC
TGCGTGGTTTTGCGGTTCCACAGGGgAAGGGAAGACGAATCCCCTTCTCCGGGCTGACCTTCACCGCTTTCCAGTGCATCAGCATCATCAGCCGTTCCGT
TGGCCCCCTTGGCGAGGTTCTGCGCGGAGTCCCACATCTTCTTGAGCGAGAATGGACTGGCGTTCTCGCTGCCcaTGCTGGCCGTTGACGCCGTGGAAGA
GACCGGCGAGGACCTGAGCAGACTGTTGAACGCGTCCTGGGCGCCATGCAGCGCGCCCTGTGGCTTCCTCGCGCCCCACTGCTCCCATGCCGAAGCGCCT
gtACTCATTTtCAGCTGCGATGGCTCGACTTGTCCGTGTGGGTCTGTGCCACATGACTCCCTCAGGAATGTTTGTCTCTCGGATGCTCTCAGATACTATA
CAACCTTGTTTTGGAACTTTCCCTATTCTCTACCTTGTTTTCGATTTTTATCCGGATGGACTAAATTTGAACAGGCTTTGGGGTAGTATTCCGGATATCC
CTACCCCTCGtGCAAAGGCGCCGGTGCAGTTCGACTGTCGTGctGTTGTTTTCCACAGGCTCAGCACCTGAGCAGACTGAATTGCTACACGCCTgCGCCG
CATTTTGAGCACTCCGAAGCTTGAGTTGGCACCAGACTCGGGGTAGGTCAAGTCGGAGTGTGTGGGCCTCGTCAACTTTAGACCAGCACTCGATCTATTT
CTCGAGTCGCTGCGTGTGACCTCCGAGTCGGTTCTCGTTTTAGAtcGTCGGCGCGTCGGTTGTTGGTTTGTTGGTTTGAcctGCTCcTTCTCGGGAaCAC
CTCAGCATCTCCATCTCCATCTCTCGGGAGCAGCATGGCGTCGGTGCGGAGTCCCAAGAGGCTGCCCGCGCGCCTCTTCGGCGGCCAGCGCGTCGAGGAC
GAAGACACGCTACGCACCAACAACGCCAGCAGCCCACGCAGCACGACGGCCAAGACGCACTTGCTCACGAGCGAcAGCAGCACAGATATTTATACCGAGA
TGGAGACGCCCGCGCAGCCCATCGACTTGCTCGAAGAGAAGCCGCCCAAGAAGAAGACCAGTAGGCGCGGCACAGGTAATAGTAGAGGCCCGAGCGGCAT
CCTGGGCGGGgCAGgAGGGGgCGgAGACGGCGACATGGGAAAGAGCGCCAACACAGCCAAGACGGAGAGCACCAACAACGACGTCTTTGACGAGGCCAAG
CAACAGCTTCGAGAAGTGTATTTCA