Description :
From Genome Similarity Track
Location :
Scaffold_129:14195- 17352
Transcript NameFunction/comments
Phypl_g3779hypothetical protein
Phypl_g3780conserved hypothetical protein
Phypl_g3781hypothetical protein

Sequence
3157 bases(100 bases per row)
aaggtggagaaggtgttCAAGCTGAAGGATACCGCTGGCTGCATGGAcatcctgctgcagggcacGTCAGGCGACGACTCGATCACCATCAAGTTCAACG
CCCAAGACaccatcgagctcgaggacgaggaggactacgacgatgacgaggaggacgacgacgaccaggagcagtcggacgacgacgaggaggacgagga
cgagctccCGGGCGTCCGCTTCACGGCCGACATCACGCGCGAGAACAAGGGCCTGCAGTTCgactgcgtggccagcagcaacctcACGGTGGAGCGCGTG
CGCTACCTGAGCGACTTCgccaaggaggccgaggacgagacgcTATACTTCGGCCCCAACTTCATCGACCTGGAGCTCGACGTGCAGGACAAGTTCTACG
GCTACCTGGCCGAGCgcaagatcgacgacgagctggcgcagttCATCACGCAGTTCGCCGACctcaaggagcagcgcgagtacCTGGCCTTCCTCGAGAA
CGCCGAGACCTTCGTCAAGCACTGAACACAACACTCGTAGCGTATTGTTGCTTGAGGCTGTGACTGACTTCCCCACAAAATAAACAGCTAGAGCCTCACT
CACCACTTGGCATGTATAGTCCTTTACAGAGTCGGTCTGCGAGCGATTGGCGGGCTACGTCGCTATTGCTGTTTTTGCTGTCTAACCTTGCATCCGAGAC
ATCACGCTCTGCATGAGCTGCGACACCTTGGGGTTCGACATGTGCCGCATAGCAGCGGACGGGCCTTCGTTGTCCACGTCACGGAAAAAGTCCGCCAGGT
CCGGGTCCGATCGCGCTGCCATGAGCTCGGGGCTGTTCATGAGGCCGCTCATGTCGGGCATGCCGCCGCTTCCTGCGCTACCAGCACTCGGGGAAGCGCC
ACCGGcaccaggagcagcgcctccagcaccgccaagACCACCCATGAGGTTGTTGAGCATGTCGGGGTTCTGCATCATGTTCTGCGCCATCTGCATCATC
TGAGGGTTCTGCATCATGCTCTGGGCCATCTGCATCATTTGCGGGTTGTTCATGAGGtcgccgaggccgccgccaccaccaccgccgccgccgagcaTGC
TGGCGAGGTTCGACAGGTCTGGCATCcctcctgcgccgccagcaggagCCGATGCCGCAGGCGTCGTCTGCATCTGGCGGAGCTTGCGCTCAGCGTCCGC
AAGTCCATCGCGGCAAGCAGCGTTGGTGCTGTCCACTTCAAGTCCACGTCGAAATGTGTCAATAGCTCCGTCAAAGTCCTTTAGCTGCCCCTGTGCGCTG
CCCATACGGGAGTAAGCCTTCACGTAGGACGGTTTGAGGGCGATCGACTGCTCGCAGTGGTCGATCACCTCCGCGTACTTGCCCAAGTACATGAGCGCCG
CAGCCAAGTTGGAGTGGTAGATATGGGACGACGGTCCGTCCggcgacagctgcagcgcctcgcggTACAGCTTGGCGGCTCCCTCATAGTCCTGGCTGCT
CAGAGCGGCATTGCCCTGAGccttcacctcctcggccttggcctccttctcctccttggacaGCTCCGGCTTCATGTCTCCGAACTTCTCCTTAAACTTG
ACCAGCGCCTTGTTCGTGCGCGTGGCATGTTCAGCGGTACCAGGAGCCGCGCCCTTGAAGAAGCCCTTGctctccagcttggccacccACTTCTTCCACA
GCTCCGGgtctgcaacagcagcagcataaTAAATAATTAGCCAATCAGAATCTATCACTTTCAGGATCTGCCACGTACGCTTCTTCACGACGGGAtcctc
gtccaccgccgACTTGGTCTCGCCCGTGCCGGTctccaggtccagcgccttgagccCAGCAGCGAAGATCTCGTCGAACGAGGCCTCGCCGTTCACCGCC
AGCTGCCGCTTCTGCTCTGCGTCGtgcacgtccacgccgaacGCCTCGCTAAGAAATAATTAAGTAAAAAATAAAATAGAAGTTAGTAAAGATCGGGATT
TTGCAGCTTATGCTGCGAATTGGAGCGTGGGGATTACGTGAGGCGCTTCAGGGCCGCGTCGACTTCCTGgacgtccacgccgtcgtgcgTCTTGAGCGCA
TCCACCCACGCCAGCGCGTTGAATAGCGTCGCCTTGCTCGCCTCGTTCATCGTGGCACGAAGTCAATCAAATTCTCCCCTTTTCTCGAAGCCACCAGCAA
AACTGCAGTCGTTGGATTGGTGAAAACGGTAGGATTGGAGTCACGTGATTGGTCAGTAAATCGAGCGAATCAAATGTCGCCGTGTTGGAAAGATCGGAGC
ACTTCAaccaagatggctacatttgtgatccaagatggaggaggagacggtCGCTGCTAATGAGGCAGCGATTCTGGAGCGGCGCCACGAGATCCGCACA
AGTCTGAGGGCGGTGGAGAACTCGCTAAGAGAAGCCGGGGCTGTCACGGATGGATACAATAGCGTGTACCTGCTGGAGTCGCCCACTGCTCATTGGGGCG
GTCTCCCATCCAGTTCACTGTTCCGTCGGCAGGCTGTGCACGTGTCCGAGGCGACTTTGGCTCGATCTGCAGCGCATCGCTTTGACTTCGATGCCCCTGA
TAAAATCCGGCACGAGTGGAGACTGTCTACATTGGGTGAAGCCAAGTGCCGACGGATTTGGAGTCTCTTTGatgccgacgaggacgagaggTGGACGCAC
GGAGAGTTCCTCGAATACATGGCGGCGTTGAAGTGCTCAAGTGACTCGGTGGAGCTAAAGGCGTTTGAAGACAGCGCGGAGGTCTGGGGAATGTATATGA
GCGACATgtgcgagctggacgaggaagGAAAGCTTACGTTCGAAGGGTTTGAGAAGTACCGAGAGCTGATTGAAGACGAACAGCCACTGGAGCGAGATTT
GGCGGCGTTGGGGATTTCCCTAGAGTGGGAAGAGTTGGAGAGGATGGAGAGGATTAAGCAGCTTTTTGATGAGTACGTGGATGATCCGACGGGTAACGTG
ACTGCTAAAGCTGCACAATATCTGTTGGCGGAGATTGGATTCGTGCTGACGAGTGAAGAGACGGCGGGGATTATCGAGAGGAGATACCAACTTGCACGAT
GTCAGCGCTTCATCCATCAACTAAAACGTACGTTGCGATTGTTTGGGTACCGACAGA