Description :
From Genome Similarity Track
Location :
contig_6:141946- 159245
Transcript NameFunction/comments
g1782.t1hypothetical protein F441_16372
g1783.t1hypothetical protein F442_14173
g1784.t1hypothetical protein AM588_10002433
g1785.t1hypothetical protein F442_14175
g1786.t1hypothetical protein L914_13793
g1787.t1conserved hypothetical protein
g1788.t1hypothetical protein PHMEG_0004847
g1789.t1hypothetical protein PHMEG_0004840
g1790.t1hypothetical protein

Sequence
17299 bases(100 bases per row)
ATGGTCAAGACGGTCGTGGGCAGCGGTCAACTCGCCGCAGCTTTCAGCGTGGGCGTGGCGGCTGCAATCGCGGCCCAATTCGTGTACCAGGCCACACTAA
AACATCGTACTGGCAGCACTCACGCTGCAAAATCCGTGACGGGGGCGCCGCGCGGGACGGACGCAACGGCGCAGGAACTGCTGGAGGAGCAGCTGTCGCG
CATCGCCGCCTTCTTCGGGCCCGAGGGATTCGCCAAGCTCAAGGACGCGTTCGTGGTGGTCGTAGGCCTGGGCGGTGTGGGGTCTCATGCCGCGCACATG
CTGGCGCGCTCGGGCGTGGGCAAGTTGCGGCTCATCGACTTTGACAACGTGACACTGTCGTCGCTGAACCGCCACGCGGTGGCCACGCGCGCCGACGTGG
GGCTGTCCAAGGTGGCTGCCATGAGGCGTCATCTGCTGGAGATCGTGCCGGACTGCGAGATCGAAGACATGTCCGTGATGTTTGAAGCGGCCAGTGCAGA
CGAGCTCCTGGAAGGTGAGGGGAGAGCTTTGGTGAAACAGTGGAGGCCTTGAGATCTGATTGAGGTGGTGCGCTTTATGGCGAACAGGCAACCCGACGTA
CGTGCTGGACTGCATTGACGATGTGAAGACCAAATGTGCGCTGTTGGAAACCGTGACGCGCAAGAAGCTCAAGGTGATCACAGCCACGGGGGCAGGTGCC
AAGGCCGATCCGACGCGTCTGCAGATCGGCGCGCTCAAGGACGCTGTCCGTACGTGATGGCTGGCGTGAAGATTGCGTTGGTTGTTTGGAGTGCTGATGT
TCTTGCGCTGTTGTGTAGGAGACCCGCTTGCGACCAAGATCCGGTACTTCCTGAAGAAGAAGGGTGTTGCGTCGTCGGATATAACGACCATTTTCTCGAG
CGAGAAGAGCGTGTGTAAGCTACTGCCTCTGGATGCCGAGCAGGCGGAGAATCCCGAGGAGTTTGGCAACGTGGACAACTTCCGCATTCGCGTGATCCCC
GTGCTGGGCACGATGCCCGCGCTTTTCGGACAGTCTATGGCGGCGTACGTGCTGTGTGATTTGGCTGGCAAGAAGATCAACCCGGAGGCGGTGGCGCGGC
TGTCCCGCGACCAGCGCAACAAGCTGTACCAGCAGTTACAGCAACGCGAGCACGTGTTGTTCCACGAGGGCCACAAGATCGAGCTGCAGAAGGACGAGGT
CGAGTTCATCTTCCAGGAGATCTGGCGGGGCCACAGCTCTGTGGGCAGAGCGAGAAACGGCGGCCACGACCGTCTGTACCTGGCTCGTTGGCGGGCGGAC
CGCCCGCTGCGCCCTGACAACGTGGTGTACCTGACGACGAAGGAGCTCGCAATTCTGGACAAGGACGGCATCGAGGGCTTCGACCCGGAAGTTGTTGCTC
GCATTGATGCACGACTGAGCCAGTTCGGCAGCTGGGCTGCTCCTGAGTAGAATTGTCCTACAAACTAGAAACCAAGCTCGTGCGTTGGTGCTGACAGCAG
CAAGTCGAGCTTGCATGTATCGCCGCTTTAGGTGAATAGACGTGATCTAAAATGGACATTTCACGGTACTACTGTGCGACATGTGCCGAGTACGTCATTC
GAATTTATCTTGGTTTTTGTATACTTTTAGCCGTTACGCCCAGTCGAGTCTCAGTTAGCAATCCCCCTCAAGCTACACACACCAAGCAGCAATCCTCCAG
CATGGCCACCGCCAAGAAAGTGACCCAGAGACTGACCGCCGAGTCCTTCAAGCAGTGGATCCAGAAGCAGGACTCCTTCCTCTTTGACTGCGATGGAGGT
GCGTGGCCCATGGGCGTTTGAGCTTTGACACGGAGGCTCACGATTTGGATACTTGTGCCAGTGCTGTGGCGTGGAGCAGCCCCGATTGAGGGCGCCGCCA
ATATGATCAACCTTCTGCGCTCGCTCAACAAGCGCGTGGTGTTCGTGGTGAGCTTGATATGACGTGACTTGGGGGGTGGCGGAGATTGACACGCGAGGGG
ATGTTGTGCTTTCGTGCAGACCAACAACGCCACCAACAGCCGTGCCACCTACGTGAAGAAGCTCGGTATGTGGCGCATCGCCCTAACTTTGTTGAGATTT
CGACTAACAGGGAGAGATCCGTTTGATGGGATACAGCTTCACAGGGCATCACTGCTGTCGAGGCCGACATCGTCACGTGAGTCGTGCATTGGTTGATGTG
CTTCATGGTTGGAGAGTATGCGTGCTGACACTGCTGTTGGACAGTTCGGCGTGGGCCACGGTGCAGTACATGAAGCAGCACAAGATTGAAGGCAAGGTGT
ACATGGTGGGTGAGGTCGGCCTCAAGACGGAGTTGGAGCTGGAGGGTTACCAGGTCAGCGGCTGGAGCACAGCGACATCAAGGGTCTCCCGCACGCCCCG
GATATTGACATGGAGACGAAGGCGGTTGTGTGCGGTCTGGACAGGTATGCCATTGGTTTAATTGGTAGTAGTAGTCTCTTGAGCTGACATGCCTTGTGCC
GTTTTTCAGGTACTTCACGTACTACAAGATGGCCTACGCCACGGCATGTGTCCGCCAGATCCCGGGCTGCCGCTTCATTGGCACCAACCCGTACGTTTGT
TTATGAATGATGCGATCAACCACGCTGAGGTTTCACTCACCCAGTTGATTCTTGATGTTTGTGTAGTGACCAGACGTTCCCGACGGATGGCGCTATTATC
CCTGGCGGTGGCTCCCTCGTCCACATGCTGGAGTGCGCCATTGGCCAGTACGTTCGTGTTGTTTCAGCCCAATGCGTTCTTGTCGCGCTAACTCGTGTGC
CATCAATTGCGTTCTTGCAGCCCGCCTGAGGCCGTGTGCGGTAAGCCGTCGCAGGACCTGCTGCAGACCATTATCGCCACGTACAACCTGGACCCTTCGC
GCACGTGCATGGTACGAAGCTGCAATCACAACGTGGAAATAGCGCCGAGATTGACCTTGTCGTGCTTGTCTTGCTGCTAACTAGGTTGGCGACCGCCTAT
CGACGGACATTGAGTTCGGCAACGCCGGTGGCCTGAATACGCTGCTCGTCCTGACTGGAATCACGCACGAATCGGAGCTGGGCAACATCGACAACGCTCT
CCACGTGCCTGACCACTACGTCGACTCGGTTGATGTGATCAATCAACTTCACGCCAAGACTCTTGACAACTAGAGTCGCTGACCACGTGACGTGACGTGA
CTTAGGACACGCATCGACAACTTCAATTGCCTGTGCTGGTTCAATAGACGCAAATCGGATCGATGTGGATGTTGCCGTACCGAATCACGGTTGCTGAAGT
TCATTCTCACGAGTACCTTACACTATGAACACCTAGACAAACTGCCTGTGAGCCTATACCGATGGTGACATATTCCCGGACGTCTTCGTCTTTAGTCGCG
GAATGGCTCCGCTACTGCCACTGTTCACAAAGGCGTCGAACATGGAGAAGCCACCGCTACTTGCAGCAGTATTGGCGCCACCTCCAGGAATGCCAAACCT
GTTAACGTTGGTAGTCTTCTTCGGGCGAACCGGGGCCGAATTCATCCGACGCGTTGCTTTCGCTGCCGTATCTACAGTGGCGCGACTACTTGCAGTTCGT
GGAGCTGGCGACGCAGCCCTCGGTTTTACGAGAGACGATGCGATCACAGGTGACATTAAAGGAGTTGGTGTCCGAAGGAAGCGAGGCATTGGTGACTTGG
TCAACCGCTTCGTGATCTCAAGGAACTGCAGCTTTTTGGTGGGCGTCACCTCCCCGTCTACCACTTCCCTTGGTCTCTTTCGCGTCGGCGCTCGCAGATT
TCCCGGGGAGTCATTGTCGCTAATAAGGCCGCTGCTGTTCAAACTAATGTTCAAGTCGCCATCCTCAATGTCCTGATTCCGTCGAGGCACGTTTGGCTCT
GCTGGATCGCTCGCTAAAGCCTTCCGAAATTCTGCACGCTTCGTTGCCAATGTCTTTGTTGCTGCGTTCCTCTGGGCTTTCTTGGTCTTTTTGCCCATCA
CTTTTGGAGTGTTTATATCTTGCATCTTGTTCATCCGAGCGAGCAGCTCAGCATTTGCTAGTCGCTGCTTGATCGTCATTTTCCCACCGTTGCCTCCTGT
TTTCCTTTTTACCGTCGGTGCTACGACGTCTTCCTCTTCCTCCACCGACGCCTTTGACTTCAATTGGGGCTTTGTCTTGCCCTGTGCGCCCTTGTTTGCT
TTAGCGGTGCTGTCCGCTGATGCTGCTGGTTTAGCTCTGCCAGCCGTGGCACCCTTCTTCGGCTTAATCGCAGTCGTGGAATTCGCTACAGCCGCCATCA
AGCTTTTATCTGCAATCGCCGCCGTAGCCTTGCCTGATTTCGCCGCCGCCGTTCGACGCTTCAAATGCTTCTTCGGGGTTGAGATTGGCAGGGGCATCGG
CTCAGGTTCGGAATCGGCTTCATCATTCTCGTCCTGTTCAGCACGAGCAGCAGCTTCAGCGACCTTCGCTTGCCGTTTGGCCTCTGCGTTCGTAAAGTTA
AAATCCAGGGGCGGCCCTCCCTTCTTCGAAAACCGCTTCTGCGGCGTCGGTCTTTTCTTCTTCGAAGGCGACGGCTGTGCTCGTTTCGGAGAACTCTGCG
TAACTGGCAGAATCAAGCTCACCATCGACGGCTCATCGTCAATATCCGAGTCGCTGTCCTTGTCCAAGGACAGCATATCCAGTAGTCCATCATCCGCCAG
CTCCAGTGGCGGGCTATCATATCCACCAAGCTCAACCTGATTCTCCTCTGAAAACGATTCGTCGTCTTCTGGCTGCACCGCTTGCGGTAAGCTAATAGGC
GTGATCCGCTTCGATGGTACAGCCTTCGTTTTCTTGGCCTGCTTCGGCTGCATCTTGGTTTTGGCCCTCTCTTTGGCCTCCTTCTCGTCCGTCTGTGAGT
CGCTGGCCGCTACCTGGTCCAGCTTCTTCTTCTTCGCCGCTTTCAACCTCTGTCTCTTCTTAAGAAGAGCTGTTTCCTTCTCAAGTTCACGTCGTAAGGC
CGCCTCCTGCTCCGTCGCCAGCTTCTTCTCCGCCTTCAGCCTCTCATTCTCCAGCTTCTTAGCCTCCGCTGTCAGCCTCTCCTCCTCTTGCTTTGCTACC
AGCTCTTGCAGCTTCTGCTTCTGCTTCTGCTTCTCCGCCTTCAACTTCTCCTTTTCACGTCGTAGTGTCTTCTCTTGCTCAGCCGCCAGTTCGCGCTCCT
GCTCCTGTTCCTCCTCCTCCTGTTGCTCGAGCAGGCGCAGTTGGCTCTGGTACATCAGCTCCTCCTCCTCCATATCCTCCATCAACATGAACTGCTGCCA
GGTTTTCTGCAGTCGCTGGCGCCGCAGCTCGATGGCCTTCCACTACACCCCCAAATGTTAGCGTTGCATGGGCGATATCTCAGTTTCTAACGGCACTACA
AACCTACTTCCAAGTTGTATGCCTCCAGCAGAATATCCTCCGGGTACAGACCGCCCACGGGGCCTGTGGCGCGGTCTGGGGCTTCCATCCGCGTGCTCGG
CTGCCAACTCCTCCTGCTCGTGCTTTAATGGCGGTCGGAATTTAAAAACAGCTGCTATGTACAATTTTCATGTGGCGTACACGTAGTTGAAGCCGTTCTT
ACAGAGGGATGATAGACATGCTTCTCTCTACAAGGGCGCAGCATAATCCCTCTTTCAACTCACTTCAGTTCCAGAAAGGGAGTCAGTCGATACAAAAAGC
AAGATCAAAAACCAACATGGCAGTGGGGGGCGACGCGAATCTCTTCCAGCTCGCGGGCGGCATCTCGTGCCACGCGTGGAACAAGGACCGCTCCAAGCTG
GCGATGTGTCCCAACTCGAACGAGATCTGGATCTACTCTGGCTGCCACGCGGCCGACCCGACACAGTGGCGCAAGGAGGCGGTGCTCACGGAGCACGACA
TGCTCGTGAGCGGCCTAGACTGGTCGCCCGTGCACGACCAGCTCGTGTCCTGCTCGCACGACCGCAGCGCCTTCGTGTGGAAGTTCGAGGCCGCCTACCG
CCAGTGGAAGCCACTTCTTGTGCTGCTGCGTATCACGCGCGCCGCCACGAACGTCAAGTGGAGCCCTGACGGTGAGTACAAGTAGAGAAAGAGGAGAGTG
CTAGCAATTGCTGACGCTGTGGTCCCATGCAGGCAATAAGTTTGCAGTGAGCAGCGGCGCCAAGTGCGTATCGGTGTGCTACTACCAGGCGGCGGAGAAC
TGGTGGGTCAGCAAGATGATCAAGAAGCACAAGTCCACGTACGTTACTGCTAATGATTGTGTCAGCTTCAACTTGATATTGAGGGTGGTTATTGGCTATT
GCAGGGTCACCGACTTGGACTGGCACCCGAACAGCCAACTGCTTGTGACCAGCAGCACGGACCTCAAGTGCCGCGTCTTTTCGGCGCACGTGAGCGACGT
CGATGGAGCTGCTGACGCCGGCCCGTTTGAAGCTCTACCGCCGTTTGGAGAGCCGCTGGCTGAGTTTGACAATGCCAGTGCGTGGGTGAACGCTGTGGCG
TGGTCCCCCAAGGGCGACCATCTTGCGTTTGCCGGCCAGGGATCGTCAATTCACATCGTTCGCTTTGGCGCGCCTGGCGAGTTCCCGACGATCCAGGTAG
TAGAGGTTGCTGGGTCGAGCTGTGCTTGCTGTAATGTGCTGACGTTTGTTGTTGTTGCCATAGTCGATCCGGTTCTCGCACCTGCCTCTGATGCGTATCA
TGTTCCTCTCGAACTCCGCGATCGTTGGTGTGGGTTACGACTTCAACCCGCTGCTGTTTTCTCAGGATGCCAACAACTTCTGGTACGCATTAGCTGAAAC
AATTGCATCTTGCTTGATCGGGGTTAATCGTTGTTTGACAAATGCGCAGGTCGTTCTCTGAATTTGTCGACAAGAAGCCTACGGAAAGCGCTGTGAAGCG
GAACGCGGGCGGCTTCAACGCTGGTAAGTGCAAGTAGTATTGTATGGACCGAACACTGAATGTATCCATGTATTAACAAACGCCGTTTCTCAACCCCTCA
GCTCGAAGCCTGTTCGAAAGCAAGGTGACGCGTGGTCAATCGTCTGATGCTACTCAGCATGATAAGAATATGCTGTGGATGTACGTTTAGCAATGTCGTC
GGACTCGCAGTCGTCATGGTACTAATATAACATTGTCCCCCGTTTACTCATCGCAGGAAACATGAGAGCAACATCACATGCATCCAGCCGTACACGCGTT
CTGCCTCGGGAAGTGTCTCGGAATTCTCCACTTCAGGTACGGCTCCAGTAAAACTTGGTCGAGCGTTTGTTTGTGGTTACGTATCACTTATTTGACGTGC
GCATGTGGCAACTGCTACTGTATTTCATAGCGCTTGACGGTCGTGTTGTCCTGTGGAAGCTCGGAAGCCTGAATGTGGAAATGAGCAAGCTGCGTCTCTA
AGAGGATACGTTTGCGTAGTAGCCCGACAAAGATAAAGCTCTTCACCATTGACGAAAACAGCAATTAAAATGCGCTAGCATCTACAGAAGGTGCAAGCAA
AGCGAGCAAGACACAACAAGATCATGAAGGCAAGCATTTCAACTTGTCTGTCGATTGGTTGCTCCTACCTACATACCCTCTTTCTCCCGTACTATAACAA
CGGCAACGACAGCTCTATTCGTACATCCGCTTGAGCCGTCTATAGTCTTGACGATATTGGTTCTCAACCATAGATGCGTGACGGAAGTCCTTCCACTCAG
GGAACTCCGTGAGTAGAACCTTCGGGTCGAACGAAAGCAGTAGCTGGATGCCCTGGCTAACGTCATTCAGCGTGCGCGCGAGATCGATGTGGTCTGGGTT
CAAGTACGCTCGCTGCAGCTCAAGCAGCTCGTAGCTACTGCGTAGGAACAGGATCGAGTACTCGCACACCCGCTCAGTCTTCGCACGCAGCAGCAGGTCA
CACGAGTCTGCCACCAGTTTGTGGATGCGCATAAATACCAAGTGGTCGTGGGCCACGATCTCCAGAGCGTCGGACAGTGTCTCGAGCGCCACGGACAGCG
CAGAAGCAGCACTCTCCGGGTTCGTCTTAATAATCTCCTCTGCACCCACCAGCACCTTCTCCAGGTCCTGCATGCCTGGCTTCACGCCATCACTGTCATC
TGCCGCACTCGGCGGCGGAGGCAGCACACTGTCGCCTCGCCTGCAAAGCTGACAGCCGCACTTGAACCCGAACTGCTCCCACAGATTCTGCTGCCGGTTC
TCGCGACTTTGCTCGCGGGGGTACAAGTACGAAATAGTGAGCTGCTCGCCCTTGGCGATGGGCCGAGCCACTCTCACCTCGGACACGCCTCCTTCCGGTC
CGGCGTCCTCCGGTGTGAACTTGACACAGTTCGGGTTGCAGTCGTGATTGAACATGGCGTTGTACAAGAACACACCACTATCGAACGCATTGCACTGCAT
GGCGAACACGTTCTGCAGCACCTGGTTGTGGGATAGCGGCAGCTCGCTGAAGTTCCGGCACAGCTCGTCGATCTGCGGGCCGAACTTGTCTCTGCCTGCA
GCCAGCAACTCCTCGGGCAGTTCACTCAGCTTCTCCGGGTACAAGTGGCCCAGATGCTCCATGATGTCGACGTAGTCCGGTCTCGACAGCACCGACTCCA
TCGTGGCTAGGAAGAACTCCGGGTCCGACGTGTCCACGTCACTCGGCCACGGGATATACACCTGCTCCACGAGCACCTGGGTGCCCGGCACGAGGTCCTG
CGTGGCCACATATCCGCGCGATCCTCCGACTCCGTCAAAGCTGGTCGCCAAGTCCACGGGCCCCACCGCCAGCGGCTTCACGTCGTCCCAAGGCTCGTAC
AGACTGCGCGCGACTTGGCTCGAGGCCTCTTCCTCCTGATCCACAGCTGCTGGGCGTGCAACAGGCGCAGAGACGATGTGCACGACCTCGTGCGGCGTCA
CCATCGAAGCCGATGTCTCCTCATCGCTGCTGTCGTCGTCGAAGAGCCCGAACGCAGCCTGCACCGACGCACTTGGCTTGCCACTCATGACGGTCTGGTT
GGCCCGGAACTTGACTTGCAATGATTGTCGTGTTACGTACAAACATCAATCGTATCAGAATGATTGCATTGTTATGTATCACACACCATGATTGCACCTC
CATACAAACACCAAGTGAATCTGGGGCATACCGACTCCCTGGCTTTTGCGAGAAATGGCCGAGCACCTGGCTTCTCAGCACGAGAATGATAGCCTCCCAG
TGCGCCCAGGGCTCCCCCTTGGGCGCCGCATGCGGTTGACGCTGGGACAGAAGCGCGAAGTGGTGGACCTGGCGGCCAGCAAGAAGTTCACGCACCGCGA
GCTGGCCGAGAAGTTCCGCGTGGGGCGCACGACCATCACCAATATCTGCCGACAGGAAGAACTGATTCGATCCGAGACGGACTCAGCCGACGCTGCCAAG
AAGAAGCGCAAGACCACAAAGTGCACGTACGACCTGCGTGTGCTGGACGAGAGTCTACACAAATGGCGCATGGAGGTGAAGGTGAGCAGTCCTGACACGA
AGCTCACGGGCACAGTACTGCAGCACAAGGCCATGGAGCTGGCCTGTAAGATGGCTGACGACCCGTACGCGGCGCTTCCCGACAAGGTCAAGCAGGCGCT
GCACAAGTTTACGGGCTCGAACGGCTGGCTGGACGGGTACCGCACAAGGTTCGGGTCTTTCAGCAGCAAGCAGCTGCCTGGAGGAGGCGACCAGAGCGTC
ATCAAGAGCGTGGACATCCAGACGAGGCTCAGAGAACTGCACCACAGCTTCATGAACGTGCAGCTCGAGGACATTTGGACGGCCAGCGAGTTCGCAGTCA
TGTACAAGCCCCCGCGCCCGTGTCTGACGGCAGTGCAACAGGGAGTAACAATGGCAGGTACACGGTTTCGCTCTTTGTCAGCGCGGCTGGAGAGAAGTTT
GATATGCAGGTTATTGGCATGGATCGCAATCCACTACTGCTGGAGGGAATCGACACCAAGGAGACGTACAAGATCCAGTATGGCTACTCCAAGACGGGTT
GGCAGGTCGCGCAGACGACAGTGAGCATGCTCAAATCGCTGAATGCTCTCGCAAGGGAACGCAAACGCACGTTCCGCGTGGTTTTGGACTCGGCGGTGCC
CCACGTGAAGGCCGCTATGATTCTGGACTCACAGGGCGACCAACGAACGTTTTTCGTGTACGACCACCTCCAAATCTACTTCTTGCCACCGAACTTCAAG
GCCCCGCGTTTCCACCCGTGCCACCTTGGCGTGATTCAAGCGTTCAAGGCGAGGTTCCGCAGTGAAATGCTCGAGACGCTCTTCAGTAATTATCGACAGA
GCGTGATCAGCCAGGACCCGCGCGGATTCCACCCGCAGCGTCACTTGCATACCAGAAACGTGTTTCACTGGTTCAATGTGGCTCTGTGTAGCCTGGATAA
ACAGCTCATCCAGACGTGCTGGGTCCAAAGCGGTCTGCTGCCCACTCAGGCCATTGCCTCCCTCAACTTACGCGCCATATTGAGCAATACCTCGCCCATG
AGCATGACCCCCAATACCTCAACTGGTAGTGGCAGTGACAGTGGCAACGGAGGTGCAAATTCCGATGTCAATGGCATGACCCCAAATGGAGCGAGTGGAG
CTGGCTCTACAGTCGTAGCACACGCTACACAAGGAGGCCTGCTGTCGCCCGCGGTACTCTATCGCGATTTACAGTTGCAACTGACGAATATCGCCCAGCT
CGCTCCGGACTTCTTGCGCTGGATTGGCGTGAGCGATCCGAGCAATGCGCAGGCATTTGTGGAGCTGGAAGGCAATGCTTCCGTAACGGACCCCGGCATC
GATGAAGTGCAGATCATCCGCGGAGTGCTTCAAAAACATGGCTACCTGTCCACAAAAAAACTGGATGATGAAAGTCATGCCGAGGGTCCGTACGAAACCT
TTGACGACGTGGCTGATGAGCCCTGCCCAAGGCATGATGAAGTTGTGGCGTCCATTGAGATCCTCAAGAAGTACCTGAGGCTGTCACGGGACGCAATCCC
AGACCGTGTCGACGCTGTAGTGCAGCTGAACCAAGTCAAAAAGGCGATTAATGCTGCTGCCTTTCGCGACGCCGCCATCCGGGAGGTATGAGTGAAACCC
ACTTGACGGAGTGAAATGTGCGGTACTGTTTTATTCTACCTGGCATCATGCTCATCGTTCTCATTGTATTGTCACTGTTGTCGGCTCTATCTTACATATG
CATGGCTCTCGAATATTGGGTGCCCTAGCTAGTACACAGTCCGGATTCTGTAGTTGGGAGGCATTGCCGCCATCACGGTGTTATCGTCTAGCCGTTGGTT
CGTCTGGGTTGGCAGCGGCGACGACATCCGAGCAGGTGGGGTTGACTGAGGCAAGAGATCATCGTCAAGCGGCAGGATAGTACGTTCCGCAATGGCCTGC
TGCTCAATGCGACGTTGGCGCCGTGCGTATGCTACGAGTGTGCGCAACGCACTCACTAACCAGTCGCGGTGGCTTGAGCTCTGGGTCTCAAGATCCAGTG
TACGATCCCGGAAAACAACCGAGAAAGAGCACGCCTCGAGCACGCTGTTGGACGGGTACTTGCGGAACACAGCCGTCTGTCTACCGTCCAGCACCTGCAG
CACTTCTGCCAAGTCAACCGCTCCACTGAGCCCGCCTCTCTTGTGCTGCCACTGCAGAGTTCCGCAACAGTTGCAATGGAGTCGGGTAGCATGAGCACCG
CCACGACGCCCATACTTGAGTAGAGGGAAGAACATGTTGATTGCCTGCACGAGATACGACCGGTGCTTGCCGCCAAAGCGGAAGGCCAGCTCCACGATCT
TCCACCGCGCACCTTCGATGGTCTCGAGCTCTTCGTCTGTGAACAAATACGTTTTGCGCTTCTTGCGAAGATGCAGCGTCTCCAGCACGCGTGGGCCGAT
CCTAGAGAACGCACTCTTCTTGTGTTTCTTCGCAGGGTGCACTTCTTGTGCAGGGTTAACTAGCGGCGGTGTCGGCATCGGAGACCCAACGAGCGGAGAC
AACATGTCAGTTGGCTCCAGGTCGTACGCATTCGGGCACGACCCAGCTCTCCTCCGCATCGGTGCAGGCTTGGACTTGCGACGGACTCCATGAGACTGGG
CCATGGGTGTGCTCAACTGGTCCGAGTCATCCTTCAGCTGGATCACCAGCCGCCGCACGCTTGAGGTAAGTTGATCCTGCGCTGACAGTGCAGCTTGCTC
GGCCGCGCAACTGAGAAGCCGAGTGCGTCGGCGCTGCAACAACCGGTGCTCGGCCGGGCTCAACTGTACCAGCTCGTGCTCGACCTGAGACGTCGCCTCT
TCTACCTCGCTACTGGATCTTCCTTCGTCGTGCTCGGCGTTGTTGTCATCGAGGTCGAGCTCCTCCACGTCGTGGATCTCGTCAACGTCCTCGTCGTAGT
CCTCGTCCTCATCTTGGTTGGACACCGCAGCCGTCGCGCTAGCTACCGGCTCACCCGACTCGCTCATCAGACTCTCGCTCTTGATCCTGTTCACGAGCGT
GCCGCACACTCGTCGACATGTTCAGCAGGTCAAAGTCCAGCAATTCCTCCTCATCACCAAAGGCTCCACTGTCTTGTTCTGCACCCGCGTCCGCTCCAAG
TGCACCCGCCGTTCCTCTTCCTCGAGGTCCTCCTGCTCATTATTGCCCCTTTCGTCCGCCTCCTCTTCGTCCGCCTCCTCCTTCTCCTCCTGTTCATCCG
GTAGTAGCGCCAGCAGCGGTGCAAAGCTCGCGTGCATGACTCCGAAAGTGTCAATCTGCGTCTCGAGCGCCGCTCTCCTCGCCAGCTCCTCTTGACTCAA
CGGCCGAGCCAACGCCGCCGCCACTAGCGGCCGCGCCGGATAAAACTGGAACCGCTGGCCGTTGCCACTGCTGCTGCTGCTGTTACTGGTGCTCGGGTCC
CACATGGTCATGGTCGAGTGCGTGGGCGTGGCGCCGACGCTGCTGCGCCGCCCGTGCCGAGCCGCCGGAACCGTCGCGACGTCGGCCGCGGTCTGTTCCT
TGTCCTCATTGCTGCTGCTGCTGCCGCGCGCCTCCTCCGGGTCCGCCTGGAACAGACTTCCGCGCCGCACGATAGCCGACAGTTTGCCTAGCAGCACGAC
GCTGGACGAGCGCTCGCGGCGTCCGCCCGACCACGGCTGCATCGAAGAGGGAGAATCCGGGAGAGTGGGAGCAGCCTCCACCCCAACGCGAAATGTGGGC
CGAGGAAGAGGGAGGAGGAATGAGAAAACCGCCGTGCAGTAACAGGCTGGCACGAGAATGGCTGCAACTGGAAGCCTGCAAGATAGATAACTGCACTTGT
GACCGAGTGGGCGTTTGCCAAGTCAAGGAGCCGTTGCCGAGAGTAGGTGTCTTCAATGTGCAATGGCTGTAGCCATGTCCGTTTTTATCAACTCTGCAAA
GTGCTGTTCCGAGCCAGCCGCTGTGTTCGTCCACAGAAGGACGGTATCAACTCGGCAGAGGGGCAACCGAGTCGCAGCTTGGCAGGATGAAAGCCGTTAC
CGGACTCCACTGGCACCTGGCGAGCGCTGCTGGCCAGAAAGCACCAAGAAGACGGCGGTCCTCGCCAGAAGTCTGGTCTCTCGCCGAGTCTCACGGGCTC
CGATGCCCTCTATCTCCACTAGCCAGCCCTGAACTCTACTGCCCACTCCTTTCAGCCGCAATATGCTTGCGGTTTGCTGGACTCCCCAAGCCGCTGGTCT
TGCCTCATCGCTGACGTACTTGTGGTACCACTTTCCGGGTACGGTCTCCGTAACGGCCAATAGTCAACATGGTGAGTGGTGGCAAGACGCCTCGTCGCGG
CCCCACGCAGCGCCGTGGCCGTCTCCAGGGAGCAGGCGCGCTGCTGCAGAGCAGTCCCGACACTGCGTACCCGTCCTCCCGTTTGCTCGTGTGGCACTCG
CGCTTCACACACGGTGCGTCTCGCCACGAGGCCGCCGTGAGCGGCCACGCTTTCAACCAGCAGCTCGAAGTGTATCTGCCTTCCAAGGCCGGGAAGGCCA
CGGCGCAGTCACTGCAATGGGAGACGGGCTTCTACTACGAGATTAAGGCGTCGGTCGGCATGTTCCTGTCACCGGCCTTTATTAAGGAGTACCTGCAGGA
CGGTGGCTCCGTGTTCATGGTGGCCAAGAACGTGGCGGTGGACGCCGCGCAGTCGGCGATGCTGCTGCCTTCCGGCCAGTTGCTACTACTCGTGGATGCA
GACACGTACCAGCAATTGGGCATCGTGGGTGAGAAATATGGTAGAGCGCTGCCTGCCACGAGCAGGACGAGGCGGGGGCAGAAGTACTCATCACGCTCGA
TTTGACGTCGTCGGCGTTTGCAGAGGAGGGGGAGAATGCGTTTAGAGATCGAGTGAGAGAGTGTTTGAGCAGCAGACTGGAGGACCTCGAGATGCTGCTG
TGTGCTTACAACGCTCGCGGATCAGCACGTACGATCTTGTTTGGAGACGATGATACGGTGCCTCGAAAGCGCGTCGAGCTTGATGGACAAACGACGACGT
TCAACGAGGTGTTTCTGCCCAAGTTCGACGCGTTTTATGCTGTGTTGAAGAAGAAGGGCGAGCGTGAGGATGGGGACAATGATAAGCTGCGGACGTCGCT
GCAGGAGGCATACGACTGGCTGGGCCTTGTGGCCTGCCGGCTCACTGACTTGCTGGAGAGACAGAAGCTGGAAGAGTACGTGTCAACCTTCTCGGGCATC
CCTGATTCGTTCGAGTGCGAGCCGGATAGCGAGATCACGACTGTGCGGTGGCGTGGTCTGGTGGCCGCTCCATTTTGCTCGACTGTTGTCGAGAAGGTGC
AGCGTGCTGTGAAGAACAGGGAGGTGCCATGGGGTGCAGTCACGGTTTGGGGGTTCCCGGACGTCTTCGTGTCGTGGGTGCAGCCTGTCAAGACTGGCAA
AGGCAGTACACGAAAGAGTGAGTCGCAGCGACGAGAGCATGGCTACCTCGGAAATGGTAGCAACAACTACACCCTGCTCATGCTTCCAAACGACGAGTAC
TTCATGCTGCAGGCACTCGGTCCACACGATGCCACCGTGTAGACGACCGAGTAAGTCGAGTATCTAGTACAGCATGGATAGCACACAGGGTTACAATAGA
ATAGAACGTTGCATCACGGTCGATCTTGGCTTTATCCGCAACTATCCGAGTAGCTAGTTAGCGAGGACGTTCTCGACGAACGCCGCAACAGTGGACGAGT
CCGACCCAGCTTCGGCTAGCGCTAGCGCCACCTTGATGTGCTTGCGAGCCGGCTTCACGTTGTTCTTCTTGCCGTGGATAAGTGCAAGCCGCAAATTCGC
CAAGAAGCAAGTAGCAGTATCACTGTTGCTGCTTAAGGCGGTGGTCGTGCTGCTCACATCGTCATCAGCATCTGCCGAGGTGATAAACTTGGTCGCCGTC
AATGAAGCAACGAGCTTCCACACGTTGATTGCAGCGTCCAAGGATTGCTGTTCTTCATAAAACCCTCCGAGCTCAATCAGGATTGGAACCAATCGGCTCG
AAGCAGCAGCAGCAGTATCGGCAGAGACGGCAGCAACAACGTCCACGTACTTCTGAACGGCCTTTGCCGGGTTTGAGATCGATAGCAGACGTGCTTCCAG
CAGGTCAGTGTCCACCGAGTCTGTCAGAGCGCCCCTCTTCTTGCTTTCTTTAACTCGAGTCAGTCCTTCGATTGAAAACGATGTTGCTTGATCGTGTTCT
CCGAGTTTGGCATAGCAGTAGCTCGTCAGGAGCTCCAACTGAGCTGCATCATAGTCTCGCCCACTTGCGGCAATAGCAAGTGACAATCCGGTCTGCAGCA
AGCGCAGCAGATGACGAAGAACGTCATGGTGCGTTTCTCGCTTCGTTTCCAGACCAATGCGCTTGAGGATGCTTGTGCCAGCCAGAACGTATGCCTGTGA
ATTCCACGGCTGGGCGCGAATTAACTTTTGTGCGTCCAAACACAGCCCCTTTACCCCGGATGGGCCAGCCTTGAACAATCCCACCAACGAGTCCAAGAAG
TTGCGATCCACCGTGTCCTTGCCAGGGGAAGGCACATTTCTGGCAGTCGAACGCAAATACTCTCCCAGGCAACTCGACACTTGAAGGTTTTGCGAGTCGA
TCGTCGCTAGAGCCAGACGCATCCATAGCGAACTTGAATTCGCTCCGTCATTGGTTTGCGACAGCGCTTGAAGGCGCGTCAGGTAAGCATCTTCAGCGCC
CACAAAGCGTTCGTGGAGCTCAACCAAGTGCAGGTTCAGATAATCGCGCGTTGTGAGCGTTGAATCAGCTTGGTCAACTGAGGACAAAAGACGCTCCTTA
CACACTGCTGCAAGACCCACTGCCTTGGAGCCAAACTTGCTCATGAGCAAGCTCGCCATCGATAGACCCACAAGCGCAACGACATTACTCTCAGCGGACT
GGGCTTCATCTCGTGGAATCAACGCGTGAAGCAAATCCAGCGCCTCGCCTCCCTTTGATTGACGGTATAGTAGCTGCGCTTGCACGATACCCTGAAGTGC
TGAGGACCCACTCGTCGCGGCAATCTTTTGCAAAAGCGCTGAATCGTCAATTCCATCGCAAGATTTATCGGAGAGCTGGCCAAGCTCAGTCACTAGCGTA
TTCCATTCAAGGCCTTCTTGGTCACGAGCAGACGAAGCCGCATGGGTGTAGGACGCCAAAGCCTCGGTGTACAGTCCGAGGCGGTGCTGAGCAACACCTA
GAGCGTGCCAAGCGCGCGCATTGAACGGGTCTCGTTCTAAATACTTCTTCAGGTAAAACATCACCTGCTCGCTATCATGCTCTGGAGCCTCCGTTATCGA
CTCACCGACACTAGCTCCATAGTCCAACAATGCCGTGCTTAAGCCAAGCAGAGCATCCAGATCCAACCCGACTTGCAGTGCACAGTTGAATGCTTCGATC
GCTTTTCTCTGCTGAACCGTTGAGCTAGCTTGGCGTCGAGCCAGCATCGCATACCCATTCCACATAGATGGGTTGCTTGGGTTCACGCTCTGCAGCTGCA
GAAACGACTTCTGCGCCAACGACGCCGCTGATGGCACGGCATCAGCTTGGCTGAGGTAAAACATGCCCAAATTGGCCCATGTGGCATCGCTATGCTGCTG
CGGTTTGGACTGCTCGTGCCCAGGCAAACTGCTTCACCAGCAGACTGTCAGACACAAGCGCCAATCCATTCCAGGCCAGCGAGCACGAAGGATCCTCCTG
AAGGGCCAACTTGAAATTCGTTGACGCTTTCGCCTTTAGCTTCGAGAGTGTAGCATCTGCGTCACTGTTGGCAAGACCCTTTTCGATAGAGAAAGCTGA