Description :
From Genome Similarity Track
Location :
Scaffold_24:14194- 23336
Sequence
9142 bases(100 bases per row)
GGTCGTGTAAAGAATCCCCACGCGACCACACCCCACCTATCCCCAACTCGGTCAAGACAGACATCGACCTCAAGCCACCTAGAAGAGTGCAACCCGCCCG
CCGAAGGGTACACAAGGTGAGAAGGAACAAGACAAGACACACGGTCCGGAGTCCCCCCTCCGTTAGTCGGTCGTCCAGGCGCAAGTGAAGAGTTGGGATC
GCTTCGAAAAATGAGCGAATCCCACTCAATCACAATGGTGCGCGTGCCCGGATTCGTACCAAGGATTTTATCGTGAATCCCAGAGCAAAGATGTCAAGGT
CAAGGTTGAACGAAGGATGGAAGTGTCGGCGAAGAAGGAATTATCGCAGACACGTGATCATCAAAAAATTTCGGTTCGTCAGAGTTTTGGGAGAGGATAG
GGTGAACCAAAAGTTAAAGAGGAAGATCACTCAAGTGATCTTGAAGAAAAACCAATACTCCCTCCTGAGGTTCCTTCGGGGACCACCGCGGGTCGTACTG
CAAAATACGACCTGCTAGATGGAACACGTCCAGCCAAAGCAGGACATGTTTCGTCTAAAAACAAAACTACATACAAAGACAAAAGATCGAAGGCTACGGC
TCAAAAGCTAAGTGCACCTGACTCCGAGGGTGACGATCAGGAAACGAGCCGGGCAGCAGAGGTCAAGATGGAAGGTTGGAAGATGGATCAGCTACAACGT
CATTTGCACTGGACCCAGCTTCAAATTTTGCGATCGACAGATCCAGTACTCACGATATCGGAACCGGAGATGATCGGACCAATCCGAGCACATACAATGG
CACCACGAGCTGCCACAAGCAAAATGGAAGTGGTACAACGTCTCACTTAAAATGCTACAAGGCGCAGGATTTGTACCGACGGCGTTCGATGCGCAGGTAT
TACTTGACTGCGACCTGGATTAGGTGATCACGGCCAGCCGATCACTGTTTAAAGCGCTGGTCCCCATGACCGGTAATTATGACTCCGCTGATCGCGAACT
CACTACCACCGTCAAAGTCAAAGAGGAAGAACATTCCACGGCTGTGTCTTCAAATGACGCCTCTGCGGAGTCGGATGCAGAGGAAAGCGATGACATGAAG
ATCAAACGAATGTCGTTGGGACCTCCCGGAGCAGAACTTTTGCGTGACCACCACGATCATACGGCACCAACCACCAGGGAGATGGGTTCAACCACTACGC
AAGTCCCTGCTACGGATGAGTCCGACCAGATGCAAGTCTACGTTGCAAAAGCCATGGAAAAGTTCTTACAGGAACAACACCTTCGACCGCTTCGTGCTGA
CCGGTCGCCTCACCTCCAATCACAATGTGTTCTGGGCGTGTATGCCGGACACCGACATGGAATCAGCTGATTAGTATGAAAGCTGCGGCAACGCATTCGA
CCCTGAAATCTCGATATCGACGGCCTCCGACGACCCTACTTGGCTACCACAGAGGCCACAACAGGAGAAGGCTTTGATGCGCAGCGGATTCGCATGTCTG
CGATTGCCGAGTTTAAGGAATTTTCAGGCCGCGATCACGACGATGACCGCGCTCGAGGATGGGTACGCAAAGTCAGGTCAGCTTTCTTGCTTGACCGAAA
CCCGGACTCGGAGAAGTGTCTGGTTTCTGTTGATCTGCCAACAGGCCCAGAACGAAACTGGTATTCCCAATTGAGTCGATCAACTCGCAATAAGTGGAAA
GATCTTCTCAAGAGCTTCCTCTTACAATGCTGCGGACCCGGCGTCTCCGCTGGGCGCCAGGATTATCATGCCTGCAAGCGTGCCGATGAGACTCCGTTAG
AATATCTCTACCGATTGAACGTTGCTGGGATGCGAGCGAAGATTCACGTGAAAGATGGGAATATCGCTGATCGCTGTGACCATGTGGAACACTATATCGA
AACACTGGACGAGCAAGACCTCGCGAATCAATTAACGCTGCTGCGATTAGATGACGTGGATACACTGGAAGCAACGCTACACACATACGAACGTATGCAG
AAACGCAAAAGCAACCTTAGACCAGTTCAAGCAAGTTCCGCTCACGGTCAGCATCACCATACACCCCAAGTTCATCTAAACCACCTCGAGCCGTGCGTGC
AATCCACGTGGGGGCGATAGCAGTACTTCGGAATCAGATATAAGCGGTTCAGACTCAGACGAAGAACAACGACGTGTTTACAGCGCCACGGCAGCCGACC
AAGCCAAAACTGGGTGACCGGGAGCGTGATCAAGATCGTGAAGGAGGACACAAGTCATGCACTCATTGTGGGTCAAAAAGACATGATGATCGTGGATGCT
GGAAACGATTTACTTGTCATAAGTGCGGACGCCGAGGTCCCCCCTTTATCAAGTGTTTCTAAGGATGCGCAGCGTGTGGAGAGGTACACGTCGGAGGAAA
ATGCCCGACGGAAAAGTTTTACAACATGCTCCGCAAGTGGTACGTGCCGACCAAACATGCCGGAATGCATCCTCCTGACGCTGAGAAGATGTTAAACTAG
GACGCTCGCCAGGTTGGAACCTGGTACGAGCTGAGCATTCTAGGCTATGCATATATGTATTCATTGAGATAGAAGGGGTTTAAAACAGTGTTAATCGCCT
GACCGGCCGGACTTTTAGCACATGTGATTTGGATTCTACTTGATTTTCTTCAATTGCAAGTCTGCGGCGACCGGACGAGTACGCACGATCACCCACCAAG
ATGGAGCTCAACCTGTCTCCTGGCGAATCACGTGGTTACTGGAAGTATCATACTCTAAACAGTGGTTCAGGCAAGCCAAGACAGGGGGAAAATCAACAAC
GAGAAGGCCACCCTACTGTTTGACTCGGGATCTGAAGTCTCAATCATCGACACCACCTTTGCTCGTAAGGTTGGCTGTGTCATAGATGAGAGTCAGAAGC
AAAAATGTGTGGGTATTGGACAGAATTTATACATGGCCGAAGGCCGCACGAAGGTTAAGATGCCGCTGAATGGTTCACTAGTCTACTACTTTGATGTATG
GGTCGGTGACCAAGTGGTACAAGAAGCAATTCTAGGAATAGATTTCGTGGTACGGGCCGGAATACGCCTTGGACTGGAGGACGGAACATTTTGTTTGCTG
GAAGAAGTCAGATTTCATCTGGAAGGTAGAAGACCACCGTATGTGGCGAAGATACAACGAATCGCTGCGGACGAAAAGTACTTGGCGATTCTGGTGGGTA
ACTCCGTGGGAGTCAACGTTGATCCAGGACGACTGCAGTCGAAATTGTGGCTAACACACCACTCACGCTGGGTACCTACAGATACGACTGGACTCGAAAG
GCTAACGTACCTTCTCTTGACCAGTCTGACTGATCAAGAGGTGATCATCCAACAAGGGACGCCATTCGGGCAATGGATGCCGGCGGATATGATACCGCGA
TCACCCGGGTATGTGTCCGTGGGGTAACGGCGATATGAGTAGTGGCAGACACTCGCGTTTGAAGCTACTAAGGACGACGAAGAAAAATAATTACCATAAG
TAGATGGACCGATGGTCGTACAACCGTCATATCCAACGCCAACGCGCAATCTAAACCGACCGCCGAAGGATATTGCAGAGACGGTCGTGGAAGAAGAGGA
GGCAGAGTTGAAAGACGATATGCCGATATATGATCACGTGGACGACCAAGATAAACTTAAAGGACCACAACCAGGACAGTCGTCAGTGGTTATTAACGCG
ATCACCATACCTGGTAGGACTAGTGGCGAGGATGACGGTGATGTGGTTTGTGATTCGGTGTAGGATCAGCTGGAGCGAAAGAGTAAACCCCAGAGAGACA
TATCGACGCGATTACCAGCGACAGCCGACATGGACACCCCCGTTAACGTGATGGAAGACATTACGTTGGTGCGGGACCAGTCCGAAACGCAGCCAAACGA
GTGCAAGGGGAATCTCACTCCCGAACCGATCAAGGATATGGTACCTGATTGTATGCAAGACCAGTTCACCAATCACCTAGACGGGACTACTGTTAAGGAT
GGTGAGGTGCATCGACCGTCCGACCATCAGGCGAACGAGAAAGCAGCGATCACAAGCGAAGGAGCACGCAAATGCTCGTCATACCAACGCGAAGGTGTAG
TGTTTTTCACGGAAGACGTTGGACAACACATGGCAGTCTTACCAGAAGTAGACGTGATGCTGAGCGAGGTAAAAATTGACGACGTACAGGTGGGCGACCC
AGGGGTCCCATTGACCAAAGAGCAAGAGGAATTTTGTCAGGTGATCTGGAAGAAACGACACCTTCTGATGGGCAACGGAAATGCCCTCACACTTGCTGCT
CGAGGTGTAATATGCGATATAGATGTTGGAGGAGCGGCCCCAATCGCACAACGAGTAAGGCCAGTCACCTCAAAGTTCCGTGAAAAGTTGGCGGACCTAA
TCAAAGGGTTACTATCGGCAAGAATCATATTTTTCTCAACTTCGCCATGGGCGTCGCCGATCGTAGTCATCGTGAAAAGAATGGGATGAATATACAACTG
TGTATAGATTACCGAAGGGTTAACCAATTGACGAGACTGATGGTATATCCCATGCCCCTGATTAACGACTTGTTGTAGGATCTGGAAAAAGCTCTATGGT
ACTGTTCATTGGATATGGCCAGCGGATTCTGCTTTGTGGAGCCGACGAAAAGAGCACGAATGATCTCTGCTTTCATCACGCCCTCGGGTCTGTATGAATG
GTGACGCATGCCGTTCAGTCTGAAGAACGCGCCGCAGATAGATCAACGTATGTTGGATAATGCGTTATATGGATATCTATGATCGGGGATCGGCCGAAGC
CAAGTGACCACGAGGCGTCTCAACAGGCCTATGTGTTTACGGATGGCGAACTAAACCCGCACCGGAACCGTTTGGTTCTAGGACGAAGGTCCTGCATTGA
TGATATTCTAATCCCAGCGTCATCCTGTACGTCTCTCTATCGAAAGGTGGAAAGATTGTTGGAAGTGTGTAATCGATCAACCTACCTAAGAACGTCTGGG
GATAAAACAAGCTTAAGTATCTCGGGCACCAAGTGTCAATAAAAGGAATCGACGCTGACCCGAAGGATCTGGGTTGTTGGTGAATATTCCTTTTCCCCAG
ACACTGCGTCAATGCAGTCCTTCCTAAGAAGCCTGAATTATTACAGTTGGTTAATTGAATACTTCACTAGATACGCCTCGGTCTTGTACGAATTGAGGAA
ATCTGATTTTCATGAGATCAGGCGTTCGCACAGCACGGAAGTTGAAGGCTCACCCAGCTATGATCACGACCATAATACCCATATTGATGATGACAGCGGG
CAGCGACGAGCAGGTGATCACGATCATCCACTGGTGAAAACGAATGGTCAGGTTCCAATTAAAGCAAAAGAGTCCGATGGAGAACATACTGGTGCTCATC
GTTGGGAGAAGGCCATGATTGCGTTCACCATGTTGAAGGATAAAGTAGCCCAAACCCCGGTACTCAAACATTTTGATTCGGACCGCCGATCAGTGATTCG
GTTTACGCTTGCAAATGGGCGGTATCCGCTGCTTTGCTACAGGACATGATGGAGTAAATTGGCCTGTTATGTTCACAAGTCGAGCGTTCAATCCAAATGA
AGTTTATAATGGAGCGGTAGAGAAGGAAGTTCTGGCCCTGATCCAGATGTTGGATATTTGTTATACGCTATCGGTCTCTCGGGATTTCAAGGTTCTCACG
AGATATTCTACCTTGGTATGGTTAATGCAGTCGTTAGGTCTCAATGGACGACTTGGCAGATGGGCAGCTTTACTATCGACTTGGAATTTAAAGATTAGTC
GATGTAACAAAGAGGAGGACGGAATCCTCGGCACCCTTGCAGCGAGTATTACACCGCGGGAAGATATAGATGAAATGTTGATCGCGATCGAACCACGGAA
GCAACCGAGACAGACTATCAGTATTCCTCTCCCTACGGTCAGACGTGGCGAAGTGCTTCTGGTCGACAGCTTTGACGGATCATCACGTATCAAGAAAAAG
GGGGGCGCCTACAGTGCAGTGAAATGGAAATCGCCTGAGTGGACCATTTTGTCGGCTGCGTCGCGCTTCGACACTGGGTTAACAGTAAACGAGGCAGAGT
ATCACGGTTTTCTGCTGAGTTGCGAGCTGCTAGTGAAACAGACAAGGGGACGACTTGTCATTTGTGGGGATTCCAACCTGGTCATCAGGCAGATGCGGGG
TGAAATTGATTGCAAAGCACAGAACCACAATTACTGCGTCTCAAAGTCCTAGATCGACTTAGGTCGTGACCGACACATAAATTCTTACACGTTAGAGCGA
TTGGAATCAAAGTGACGATCGACTGGCTAGCACCGCTTAACAGTTGGAAAAAGGCATGGTTATGCTAACTGATCAGGACCGCCATGATCTGAAAGTTGTC
GACCGACTGGACGAAATATTGATGCCAGCGGGAAATGATCAAGTGATCACGAATGGCGGTGATTACGCAATCGACCATGCGAAGGCGTGAGGCACTCACC
ATTATACAAGAACGGGTAATATAGCAGATGCGACTCGACCGTATAAAACAGGCTTAAGACGAAGAAAGTTGGATCACCAACCTCAAACTTTACCTAGTCG
GAGATGTTACGGAACTGGGTGCTACAGAAGCAAAAGCAAGTGCTGTGTTCCCCAGAATACGTGGTAGATGAAGGCGGATTGTTTTATTTTTGCCCACGAT
CGGCAATAAACCGCGCCGTGCTAAGCTCGTTCGTTTGGTAATCCCGGAGTTGCTTTAAGATGATATTCTAGACCACTACCACGCAAGTCTATAATGTGGT
CACCAAGAGGAAGGCCACACGTATCATCGTGTGCGATCACACTTCCCTTGGAGAGGTTTGTTCAGAAGCGTGCAGCAGTATGTGGGGAAGTGCGTCAACT
GCGAAACCGGAAAGGGATGTCTGGCGCTACGAGGAGAATCCTCGGGGAACATGCAAGCTATGTACCCGTTCCTGGTTATCTCAATAGATCATATCCCTTC
TCTGCCCCGGTCATTCAAAGGAAACACTGAATTTCTTCTTGAGGTTGATTTGTTCTCCGGCTACGTGACCGCTAAAGCTAGCTTGTCGAGGACGGCCCAA
ACGATCGCGAAAGGATATTTAGAATGTGTCTTCAGGCGATTTAGATCAATCGAATCTATTCGTCATGATCGCGAACCTGGGTTTAGGTCGGTTTTTTTTG
CGCATTCAACCGTATTGTCGGTCAAAAGCAGCGTGCTACAATGGCGTTTCGGCCCCAGGCAAATAGCTAGCACCGCCGATCCGATGGTCCAAACGTTGAC
CAGGGCGCCAAAGATGTATGTCACGGACGTGAACTAACAAGACATGGATGATTACGCCGAGCGATTGACCTTCGCCATTATTACGGCGCATGACCGAGTT
CGGGTTGATTCTTCGTTCTATCTCATCTACGGATGGGACTCGCGATCGACTTTGAAAGCAACCCTTCCGTTGGGATGCATCAAAACACGTGATCCTGCCC
CTAGGAGATGGTGCTATCACATACAGCGACAGTTACAACGTGCCCGGGCCACCGTGAATGACCGGCTAAAGGAAGCTATTCAGGACCGGGCTGGCCAACA
CAACAATGATTAAGGGCCACATGGAATAAGCTGTGGTAGCCAAGTGTGGATATATTTGGATTGAGTGAAAGAAAGATATGCCATGAAGCTGGCTCACATG
TGGCATGGCCCATTCCGGATGATCGAAAAGTGTGGAGAACATGCAGTGCGGCTGGAAGTGCAGGGAACCCCATACCGATTGTTCCCGCTCGTGCACATCT
AAGTTCAAATTGGTACGAAGTTTTCCTGAACGACCTGTTGCACGGCTGGAGGTGGAAGAAACCGAGCGAGTGAATTTTGATGAAGCCCTAATGCCGGACG
ATAGTTGGGAAGTCAATCTAGCCGGAGAGGTAATACTAGATGGACAGCATTAGACATGTGAAGTCGGGGCGAATTACTCGATATTGAAGAATACACCGAC
CGTTCTTGGTCCGGTGAAAGGGTCATAATGATGAAACCCGGGTGGATGAAGCAAACCTCAACTGTGGTGCATTGTTGCAAGAATTTAGACGTGATCGAGC
TAGACGGAATCGGTTTGAAGTGATGCAAGTACACGAAGAAGAATTCATATTTTAGGGTGACCAGAGGTGCTTACCTCGACACGACGAATGGTGATTGTCT
GGTTTGCGAGCGGAAAGCAACAATAACCACGCAAGCCGGCAAAGGGGAGGATTTACATACTTTACGAACGTTACGATTATGAAACGAAAAACAAAGGCGA
ATTGAGTAGTTACGACATGCGGTCACGACTGCGGCCACAAACACAATGGTCCTTTATACCAGAAACGGCCAATCACTTCTCTACAAACTTGTTTTTAAGG
CGGTCGGTGGACGATCCCGGGTGGTCAGCGATAGTCGTCCAGTATTGATTACGCCAGGGATCTGCATAGGTTCGTCAGCCACAAAGCGGAGGCCAAATAA
AAGTTGTTGGTTTGTCGGCAGTCAAAACCTGGATGCCACAGGTATTTCTCCAAGCGTCCGGAAAATTGCAGGAAGACGGGTTCTAACAGGATTTCATGGT
CGCACTGACCCTCGACCAACTCCTGCAGCACGATCCGTAGCACAGCCTTCCACCAGGGACTAGATCTGGAACGTCGATGACGCCTCTATTCATAGTAGAC
GCTCAAACCAGTATCCTTCACGCGGCTGGAACCGATGATGATTAGTATCACATGGGTGGGCTCCCATAGCGCCTGCCTGGCAGTGATATTCTCTAAAATC
ACTTTAGGCAGTCACCAAGTCTTGAAACCTGCCAGTCGGACGAAAAGCCACAGGCGCGATCAGCCGATCCAGGATGTCCCATGGTCTTTGACTATATAAC
GTAGCGATTTGCACCGAAGTCACCAGTCGTGGACACCATTGGGACTCGATAGGTGGACGAGCGCGGGGTTCTGGAATGGGAAACAAGTATTGCTTGAGCC
GAGAGAAGTAACGGAACAAGACGTCCAAATCCAGTTCACCCACAGTGACCAAACCCAAGCGGCAAGACGACCACGGCTAAAACTGGCCGGGGGCATAAGT
CGCACGAGCGCGATACCCAGGTATCCACTTATTACACGAAGA