Description :
From Genome Similarity Track
Location :
Scaffold_93:141925- 143894
Sequence
1969 bases(100 bases per row)
AAGTGGCGTATTGTTCATGCCTTCAACAAGCTGAACACCGCCACCATCCCGGCTCAAACATCAATCCCCCGCAAAGATGTCATCATTGACGGCATGGTCC
GTTCCAGCATCTTTTCCACCATCGACTTGCGCGATGGCTTCTATCAAATCCTGGACGATGTGCCCAAAACAGCGGTATCAACCCCCAGCGGCATGCTCTG
GGAGTGGCTGGTGATGCCACAGGGGCTTTCCAACGCCCCCGCCACGTTCAATTATGGTGACCGCAAAGTTTCGCGCCCTGCGTGACTTCGCCCCCTCATA
TTTCGATGAAATCTACATCCACAGTCGCGCGTCGGCAACCTCTTCGGATGCCGAGGTACATCGCGGACATCTCCGCGCGGTTTTCGAAGTCCTCCGCGCT
AACGGCCTTTACGCCAGCCAACCACGCCAAATGTCGCTTTGGCGTCGACGAAATCCCTGTTCTCGGTGACTTGGTGGGTGTACGCGACTGTCGGGCTGAT
CCCGGCAAGATTCAGGCCATTGAGGACTGGCCCACCCAATCCTCCGTCAACCACCTCCGGCGTTGGTTAGGGCTAGCCACCTACCTCCATAAATACTCGA
CGAACTTCGCCGACCTCGCCCAACCATGGTTTCGTCTTTTGGTTTAAAACCCTCCTTGGGTGTGGGGGGACTCCTGTCAATCCTCCTTCGATGCCCTCAA
GACCAGTCCATTCTGGCGCTTCCTGACTTCGGGCGTCCATTTTCGGTTGTGTGCGATGCATCCAAATTCGCAATTGGATGTAGCCTGAAGCAAGCCGACG
CGGACGGACGCGCCCGTCCCGTGTCATATCAAAGTCGAAAACTTCTTCCGGTGGAACGCTCTTATCCCGTTCACGATCTCGAACTTCTGTCGATGAAGTA
CGCCCACATCTAACTCCTTGGTAGCAAGCCCTTCGTGACCTACATCTACGGATCACGTCTCCCTCCACACGGCGACCAACTGGCCGCACCTCTCGCAGTG
AATGGATCGTCTTCGCTTGAGTTTACCTTCACCGTCCAGTACAGTACAAACCTGGTAAGGACAACATCCTTGCTGACGCCCTCTCTTGGCGCCCCCCGAC
CTAGCCCTCCATACTGTCGGGTTCCTCCATTTCGACCTCCAAAATCGCATCCGCGCTGGTTTACGCCTCGGATCCCACGTGTTCCGCGCTTTTGTTGGCA
CCTGCTTAGTCAAAGCCAAGCCGTTCCGTGTCATTACTGCATCGCTATTTCGTCCGCGATGGTCTCTTGTACTTTAACCCATCTCGCGGCGACGAACCTC
GCATCGTCGTACCAAGCGACGCGCCATTACGCGTCGCAATTCTCCGGTCCTTCCATGACTCTCCCAGCGGTGGCCATTTCGGCAGCGACAAGATGTTCCA
CGCGGTCGCGCGTTCATACTGGTGGCCGCGTCGCTATAAATCCGTGGTTCACTACGTCGCTCATTACGACGCCTGTCAACGCACTAAGATCACCACGACC
TCCAAAGCGCACTTCCGACGAACTTTGGTCGTCGATCAGCACGGACTTTATGTGTGGCCTTCCGCGCGATGTTCGCGGCCATACCGGCATCATGGTGTGT
GTCGATCGCGCCTCCAAGTACTGTATGTGGTGGCAATCCCCGTCAAGGACTCGGTGAGCGGCCACGATGCCGCCCGCCTCTTCTTCGACAACGTCTTTTG
TCGTTTCGGCCTCCCGCGATCCATTGTTTCCGACCGCGACCCCCGTTTCACTGCTCACATCTGGTCGACACTCATCGACCTCTGCGACACTGACCTCGCC
ATGTCCACCTCCGACCACCCTGAGTCAGACGGTCAAACCGAGCGCGCCAACCATGTCCTCGAGGACATTCTCCGCTCCTACTCCGTCCGTCAGTCCTCCA
CGTGGAGTACCCTCTTACCCCACGCAGAATTTGCATACAACACTTCGTTCGGGCGTCCACCGGGTTCTC