Description :
From Genome Similarity Track
Location :
Scaffold_93:141924- 143971
Sequence
2047 bases(100 bases per row)
CAAGTGGCGTATTGTTCATGCCTTCAACAAGCTGAACACCGCCACCATCCCGGCTCAAACATCAATCCCCCGCAAAGATGTCATCATTGACGGCATGGTC
CGTTCCAGCATCTTTTCCACCATCGACTTGCGCGATGGCTTCTATCAAATCCTGGACGATGTGCCCAAAACAGCGGTATCAACCCCCAGCGGCATGCTCT
GGGAGTGGCTGGTGATGCCACAGGGGCTTTCCAACGCCCCCGCCACGTTCAATTATGGTGACCGCAAAGTTTCGCGCCCTGCGTGACTTCGCCCCCTCAT
ATTTCGATGAAATCTACATCCACAGTCGCGCGTCGGCAACCTCTTCGGATGCCGAGGTACATCGCGGACATCTCCGCGCGGTTTTCGAAGTCCTCCGCGC
TAACGGCCTTTACGCCAGCCAACCACGCCAAATGTCGCTTTGGCGTCGACGAAATCCCTGTTCTCGGTGACTTGGTGGGTGTACGCGACTGTCGGGCTGA
TCCCGGCAAGATTCAGGCCATTGAGGACTGGCCCACCCAATCCTCCGTCAACCACCTCCGGCGTTGGTTAGGGCTAGCCACCTACCTCCATAAATACTCG
ACGAACTTCGCCGACCTCGCCCAACCATGGTTTCGTCTTTTGGTTTAAAACCCTCCTTGGGTGTGGGGGGACTCCTGTCAATCCTCCTTCGATGCCCTCA
AGACCAGTCCATTCTGGCGCTTCCTGACTTCGGGCGTCCATTTTCGGTTGTGTGCGATGCATCCAAATTCGCAATTGGATGTAGCCTGAAGCAAGCCGAC
GCGGACGGACGCGCCCGTCCCGTGTCATATCAAAGTCGAAAACTTCTTCCGGTGGAACGCTCTTATCCCGTTCACGATCTCGAACTTCTGTCGATGAAGT
ACGCCCACATCTAACTCCTTGGTAGCAAGCCCTTCGTGACCTACATCTACGGATCACGTCTCCCTCCACACGGCGACCAACTGGCCGCACCTCTCGCAGT
GAATGGATCGTCTTCGCTTGAGTTTACCTTCACCGTCCAGTACAGTACAAACCTGGTAAGGACAACATCCTTGCTGACGCCCTCTCTTGGCGCCCCCCGA
CCTAGCCCTCCATACTGTCGGGTTCCTCCATTTCGACCTCCAAAATCGCATCCGCGCTGGTTTACGCCTCGGATCCCACGTGTTCCGCGCTTTTGTTGGC
ACCTGCTTAGTCAAAGCCAAGCCGTTCCGTGTCATTACTGCATCGCTATTTCGTCCGCGATGGTCTCTTGTACTTTAACCCATCTCGCGGCGACGAACCT
CGCATCGTCGTACCAAGCGACGCGCCATTACGCGTCGCAATTCTCCGGTCCTTCCATGACTCTCCCAGCGGTGGCCATTTCGGCAGCGACAAGATGTTCC
ACGCGGTCGCGCGTTCATACTGGTGGCCGCGTCGCTATAAATCCGTGGTTCACTACGTCGCTCATTACGACGCCTGTCAACGCACTAAGATCACCACGAC
CTCCAAAGCGCACTTCCGACGAACTTTGGTCGTCGATCAGCACGGACTTTATGTGTGGCCTTCCGCGCGATGTTCGCGGCCATACCGGCATCATGGTGTG
TGTCGATCGCGCCTCCAAGTACTGTATGTGGTGGCAATCCCCGTCAAGGACTCGGTGAGCGGCCACGATGCCGCCCGCCTCTTCTTCGACAACGTCTTTT
GTCGTTTCGGCCTCCCGCGATCCATTGTTTCCGACCGCGACCCCCGTTTCACTGCTCACATCTGGTCGACACTCATCGACCTCTGCGACACTGACCTCGC
CATGTCCACCTCCGACCACCCTGAGTCAGACGGTCAAACCGAGCGCGCCAACCATGTCCTCGAGGACATTCTCCGCTCCTACTCCGTCCGTCAGTCCTCC
ACGTGGAGTACCCTCTTACCCCACGCAGAATTTGCATACAACACTTCGTTCGGGCGTCCACCGGGTTCTCGTCCCATTAAGCGGTTCACTTGTAGCACCC
CTGGTTGCCTCAACTCCTAGACAGTCCTCGCTTGAGGGGGGAGGGAT