Description :
From Genome Similarity Track
Location :
Scaffold_41:14191- 20002
Sequence
5811 bases(100 bases per row)
CATGAGTGCTCTTCGACCCAGTGCCTCCAAGGTCGACGTTGGGTTGGAGCGCAAACTGCGCTATGAATTTGCTAAGCTGAAGGACAAAGGCCAGCTACGT
TCTCTGTATCGCAATCAGTATGCAAAACCAGTTGCTAGTCAAACCACCACTTTTTCGACGGTGCAGACAGCCGCAGGTCACTCGGTATTGACGAGCGAGC
CCTACACCCCCACACTTATTGGTGGGAAGCGCGTTGGGGTGAAAGCTGACCTTCAGGGCGACGCTCAAAAACATCAACGGCGTACGGGAAATCTTGCCGA
AGGGGTACCTTAAACTCCCATGAGTTCTCAGACTCAGGGTATCTACGCCACTTCACCAGATACTGGTATTGACCTTTGTGACGACGCCGCTTGAGAAGCT
TCTCCACATGGAAGTGCAAGCTCCCTTGCTAGTCGAGCAACGCAGGAGGGGGTCGGTGTGTCGGTACAGGCGCATAAAGACTTGGTTCCAGAGGTGGCGC
GACTTCGCGAGTCTTTCGCTCACGTGCAGGCTGCAATGGATCAGTCTGTGACTGAGAGGAAATAACTCCGGGAGATCCTCGACCAAGTGCAACGCGCTCG
TGAACAGTCATCGACTGATTTGGCTCAGTTGCGTGACCAGATGAACCGTCTCGGCTCGATAGACTCGGTCAAGAAACGACTGCAGAAGGTGGAGTAAAAC
CTGCCTCGACTGGATGGCCCGATGAAGCGTGGGCGCAACTTTGTCTTGAAGACGGCAGTACATTTGTAGGTAGGTTTTTAGCATTTAGTAAGACTTGGTC
TCCAACTTCATAAGATTAAATACATCCTCTGCCTTTAGCATCAGCTTCTTCTTTTTGTTTGTCTTGCTATCAGCCATTGCATCACGCACATGTCTTAAGA
CACTAAAGCGCGTCGTGAGAAACTCGCTCACTTGTTTTTGCTGATTTCAGCAAGCTTGTCAGCATGCTCTCTCCCACCAAGCCCAGAACCACGGAGTGGT
AACGTGAGCAGAAGGCGGGGGTGCGTGAGGCTATTCACATAGAATGGAGTAAATCCGGTCGAGGCATGACCAGCGTTGTTCAACCCAAACTCAATGACAG
GGAGCATCGAGCTCCAAGTCTTAGGCGACTCAGCACAAATACTACGAAGGACGTCGCCAATGACGCGATTAACTCGCTCAGTTTGACCATCGGTCTGCGG
ATGGTCCGCTGTGGACATGTCTAATCGAGTGCCATGCACATTGAAGATGGAAGTCCAAAATTTGCCAGTGAAGCGAGGGTCGCAATCAGAGATGATTGCC
AGCGGCAACCAGTTGACGAAACACACGATCGATAAACAGCATAGCTGTACCTTTGCCATCGATGGAATCCGGCACTGCCGCTAACTGAGCCATCTTACTT
AAGCGGTCAACTAAGATCACAATTCCCGCATTGCCGTCACTGTCTTTGGGAAGACCAAACACAAAATCCATACTGATGGACTCTTAACACCCCGTAGTCA
CAGGTAAACTGGCGAGTGGCGCAGCCGAATTTGCCGCGGGTTTTACCCGCTGGCACGTTTCACATGTACGCACGTATGTGCCCACCCATTTGTAGAGTTT
GGGCCACCAGTAGTGTTAACTCACAGAGCCATAAGTCTTTTGCCGGCCAAAATGCTCACTGAGAGCAGTATCGTGGGCCTTAAAGAGGGTTCGGTACTTT
AAATCCTGATTGTGAGGCGCAACAATGCGAGCGGTATCCGCTACATCTGTGCGATAACACAAGAGGCCATTATCGATGGAATATCGATACTGGCTGGCCT
GCAAGCATGCCGATAATTGACTGTCCGAGTCCTTGTATTCCTCACTCCCAAGGGCATGAGATAATGCCACACAATGAGGATCCCGTGGATAGGCCACAAG
AATGAGCTCCTCAATAGGAGACGATAAAGTCGTGAGATGAGCAAGCTTATAATCAGGTCTGCGAGAGAGGTCATCTGCCAACACATTTTGTTTGCCTGGC
TTATACGTCACCTCGAAGTTATATTCCGCAAAGAAGGAAATCCACCGAGCCATTCTCTGAGAGAGGTGAGGCGACTGTGTCGCCGCGCGTAATGACGCAT
GATCCGTATAGACGACAAATGTCTTGGAGCCAAGCAGATGGACTCTAAATTTGACGAGCGCATAATTAATAGCAAGTAGCTCTTTGTCATGAGCTGGATA
GTTCTTTTCAGCAGCTTTCAGCTGACGAGATTCAAATGCGATAACTCGCTGGCTACCTGCAGCATCTGTTTGTAACAAGGCGCTGCCTATAGCAAAATCG
GATGCATCGCAGACAATAATAAAGGGGTAATCAGTATTTGGCAACGCCAAAATGGGAGCATGGTGGAGACTCTCCTTTATTGCCCGAAATGCGTCAGCAT
GGGTGTTGTCCCAGCGCCAATCCGTGTTCTTCTTAAGGGGATCAGTTAATGGCCGAGCCATATCAGCGTAATTTTCACTGTATTTGTGTAAGTAATTGGC
AAGGCCAAGCCACTTACGCAAGTCCTTTTTATTCCTAGTAATATGTCAGTCCACAATAGCCTTGACCTTGGCGGGATCCACTCGAAGGCCGCGCTTGCCA
ATGAAACAGCCGAGAAAAGGAATCTCCTCTGCACCAAAAATGCATATAGACGCGTTATCGTACAATTTATTAGTGCGCATGCAATCGAGCAGGGCTTGCA
AACGACTGATGTGATTTGCAGCATCTTACCGACCTTGTTCGGCACTACTACGGACAAAAATGTCATCAAAGTACGTCTGTGCGTAATCTCTATGTGGGCG
GAACGTTGCGTTACCAGACAATTAAATGTTGCCGGAGCATTAGACAACCCCTGAGGCGTCACCGGGCATCACCAGCCATAGCATACCACTCGGAGTGCTC
ACTGCTGTAAGTGGAATATCACTCGCTTGCATGAGCAATTGATAATATCCATCGACCAAGTAGAGTGCACTATACATAGTACGACCAACCATGTTGTTTT
GAAGAACATCCTTTCGAGAAATGGGTGTCTGTTCCGGAATCGTATCCGAATTAAGCTTGTTATACGCATGCACAACACGCCACTTGCCGTTCGGATTTTT
GACACAAAATGTCGGTGTCGAATATGGAGATTTACTCTCACGTACCATCCCTGCCTCGTGCTTGGCACGTAAGAAGTCATCAATGACATCAAATTGCTCC
TTAGGCAAGGGCCACTGTCTTGGGATACAGTATTTAGTCCCAGGAACTTTGTCAGTTTCATGACGGACGTCTCTATCAGGAGGGTAGAACAGAGGGTGGA
TAGTGGCACACCACATCTTGACTAAGGAATGAAAGGGATCTTGAGGTTCTCTCAATATTGATGACCCACTACGCGCACTGAGTGCTGCTTTTGTGCCCTC
TAGAACGGCTTCATCCAAAATTGAAGAAGAGTTCTACTCTATGATGTCGGGTCGAATGATCACCACATCTGAAAGTTCTCCATTCTTTAGTAAGTGATCA
AACTCATCGACCGACAAATCTTCGAGGTTTCAAAGCGAACTTAACGAGGGCATAGCCTCAAGGCTAATTGTACCATCACAAGCACCAGTCACTCCGTTGA
CGAGTGTATACAGCTGACAAGTATCATCACTGACATAGAACACAATGTGTAATTCGTATCTCTCTGATTGATACCATAATCGAACGTAATTTTCTTTAAA
CTAGAGCTGACGTCACTATTGACATCCGATGACGAGTCATTGGACATGACGTCTTCATCACGTAGATTACGTGCCACTTCACGTGCATCCGCTGAGCTGG
GCTCGGGATGCCTTGGTATTTCACCAACAACGTCAATATTGACATTCAGCGCGCTGCTATCACAGCCAACGTCACTCAGTGGGTACTTACATGCTACTCC
ACGCTCAGATGATGGGTTCAGCCCTCGATGACTTGACGCTTGGTCAACAATGATTTCAGCATTCAGTACGTTGATCTCACAACAACTATCACTTAGCGTA
GTACGTGCCGCTTCAATATCACATATTGAGCTTAGCTCTATATTCATGTCTTTGACATCGTCAGAATCAACTAACTCTGACATTTCGATGTCCAACATAC
TGACATTGTCAGCCAGTGGCTTGCACCAATAATGTTTCTTATTCCTAGCAGAGGTGGGTTCATGACTCTCCAAAGCTCCGCCAGGGGCAGTGTGCGTGGT
GCCAAATATTTTCGACCTCCAGTCGATCCATGGCTGATGGCGCTCAAACCAAGTCATACCAAGAATGAGATCATATCTCGAGTCCAAATCAAGGACTAAA
CAGCGTTCGATACTATCAAAATCAAATAACTTCACACCCAAGTTCACAGGAACTTTGGGTGCGGTGACTAGAGTTCCTGTCGCCAAGCGAACAGTGATAG
TATCACCCCCGTGCGCTTTTAGCGCCTCAACATGACGTGGATTCCCTTCACGGGAATAGCGTCTGAAATAATTACCGGATGCTCCGGAGTCGATCAAAAT
CGACCAGGGTTTGTAAAAGCTCTTAACAGTCGCCTTTGCGACCAACAAGCCTGGCTTGTATTCACGCCCCGTGTTAGCGTGCACAGGACTCCATGGGGCT
AAATTCTGCTCGCCACTACCTCCTAGAGGCTCAACAGAACCTAGTTCATCCCCAACAGGGCGCCCCTACTGGGAGTCTACGTTTTCCTGCACCGTACCAG
ACTTCTGGTTAGCGGCGAGAGTTCGTATTGAAGATGCCTGGCGAGCCTTACGTAATAGTAAGGGAAAATTACAATGCAGATGCTTTGTGCTTCCGCACGT
GAAACATCGTCGAATGTTTCAATGCTATTTTACAGCTCGAAGATCTGCTTCTTCGTCCGTCCCAGCGAGACTGAGGTCCATAGTCTCCGGCCTATAGAAT
GAACTAAAGGAGTTCGTCGAGTTTGGGTTGTAACCATGGGTGCCAAAACGGGCTGCCTTAAAGTTGAACTCAGCATTCAAAGAGATATCCACAGCCGCCT
CAAAGAAGGTGGGGTGTACCCGAAATACTTCCGTTCGAGCTACGCCCGTACGAAGGTCCTCCGTAAAGATGGTAAATAAAACCATTTATGGTAAGGGATC
AAGCTGCATGGCAGCGATTAGAGTTCTCAGCTCCTGGACATAGTCTGATAATTCTTCTTGCCCTGACGGGCAGATAAGAAACGAGATTGCACTCGGTATG
CCTGATTAGTCGGAGGAAACACTCGGAATATTTGCTATTTTAGCAAATCTCATGTGGGGAAAGCTTCGTCTACTGACGTGCTACACGTGAGAGCCCATTC
TCTGGCTCGACCACCTAGTTTCGAGATAGCCATCCCAACTCGCTCTTGCTCTGGTCGGAGCAACAGCGAGTTCATGGCCATTTCCACCTCTCTGACCCAC
AGGAGGAGATTCTCCCCTTCTTTCCCTCAAATATCTTTACAGTCTAGACAAGAGGGCGAGCCCTTGGCTTTTCATCGGGTACGGGGACATACCGAGTAAG
CATAGCCGATGCCAAATGGTCGTGTACTTGCCCAATCAAAGTGGACTCAAAATGCATAAAAGCGTCAAGACGTGTACGAATCACGTCAGGACCTTGTGCG
AGGATTAGATCCACTTGTTCGTTCCCGACTAGCGCTCTGAGTTTCTCCAGCACTAATCCTTGGGCCTCAGAGAGGGTTATCTTTGTTTACATCCTTACAG
AGGAACAGTCTTTAACAGACTCAGGTGTGGATTGACTACAAGTGCTACCAAGTGTAGCAGGGCTACCCTAACTCCTTAGTCAGAGGGAGACTTCAAGACT
TGTAGAGTCTC