Description :
From Genome Similarity Track
Location :
Scaffold_843:1419- 5835
Transcript NameFunction/comments
g16161.t1KUF93534.1 Phosphatidylinositol 4-kinase PIK1 [Phytophthora nicotianae
g16162.t1hypothetical protein

Sequence
4416 bases(100 bases per row)
ATATATCCAAAGAAATTTGCGTCCATTATATAGGCTCTCCCATACACTGGTATATGTTCCCTGATGTAGTACGTGATAACAACATCATTTAGCCAATTAT
CACATTCCAATGTCTCCAGATCGGTTCGCCGAACAACCAAGCGAATGTTGGTTTTTCCAGGAGCAAAGCTGGGAGTTCAAATCTCGCAGACAATATTGGA
TGGGTCCACATACGCGTTATCATATTCTCCACCAGAATCATATTCCATCGCCTCTTCAGTGCTGTCGACCAATGATATAATCTTGGGCGGTTCCGTCGCT
TTATCAATCGCGGATGGCGTTTCCAATGGAGAATGGTGAGCTCCGATTGGCGATAAAGGCACCTCCAATTGAGAACCTGGGATCGCCTCACAGCTTTTAG
GCGACCTTTTCAGCGGCGCTGGAGGGACTTTAGCGGGAGAATCCGATACCGCAGGAGGGGAGACCTTGAACTTCTTCTTCTTGCTGGGCTGCATGTGGAA
ATCGTAGGTGGCAATAAATTCACTAAGCTTGTGGCGCTTGATAAATATATTTAACCACGACAGTTGTGCTCCTCTCGTACGGGTAACGAACCCAGGAACT
TTTACTGCACAGTCGTCGACGATAGCAGCTCGCGTCATCTGGGCGTGGATATCGCTAGAGAGCTTTATCATGTTCACGAGGTCCTCTTCATAACCGTGTG
TAGATGATGGGGGACCGGGTCGAGTCGTGGTGGCATTGTTGACGCCTGCTATGAGTTTCTCTTCATCTGCGCACCATCCCAGCAGCGTTGATCGAGAAAC
CCCCAGGTGTCTGGACGCTTCAGTGGTAGTCCACCCCTCCAGCTTCCATAGTGATACAGCCTCCAACTTCTGTTGATCAGTGACCGTGGTGACCGTGTCC
ATCGCTCGTCGCTTTCCAAAGTGAGAATGTTCGTACTATACGGGTTACTCGACACATGTACGGGTTACTCGAGACATGTACGGGTTAGTCGACACATATA
CGGGTTATCCGACACATGTACATGGTTACTCAGCAGCCTATCGCATTTCTGTTTTTTCTGATATTCTTGCTTACACTTATCACACGTGACCTGTCACTGA
GAGTATGTCTTGTGTGTCCACAGGAGCTGGATCTTGGATTCGCTCAGTTGCGAGGAGAAATCTGTAAGCGATGATGCGCTCGTCCAGATCACCAGATCGA
AGCAGCTTCCGCATCTCGCGAAGCACGCTCCCGGCTCCCTTGGCGTTGATGCCATTACCCCGCAAGTACTCGAGCACATTGCGCTCAGTGAGACGACCAA
TTTCCAGCACGTAATCCTTGAAGTCCACCGTCTTGGCGTCAAGGATGAAGCCCTGATTGAGGAAGATCTTCATAAAGGTGACAATGTGGCGGGATTCAGA
CTTCTTCTGGCGATCGGCGGAGTCCCAGGCGCGCGGCAAGCGCGTGTACCACTTGAGCCACATTGACGACAGGTTCGTAGCTTGTTTCTTTCTGCGTTTA
GGCTTGGGTTCTTGATTTGACGCTTCATATGATTGTTCTACTTCAGTCGTTTCTGGTAGCCCCTTAGACTGAAGCAGCGCAGCCTCGACAATTGTCATGC
GCGCAGCCATGGCCTTGTTCGAGGCAATAAGCTCATCAATTACATCTAAAAGGTGATCGATTCTTGGGCTTGCGTACTTGCTTGTATCTTGCTCTGATTC
TTGGACAGGTTGAGAGGCATCGTCATTCAGGGCGATAGACCACGCGAGCATGTCGGCAGTCTGGATGTCAACAGCCACCATGCACTCATCCACACGCATC
ACGATGGGGGCAGGTGGAGAAAGCTTCTTCAACCTCGGGTAGTACCGGATCAGGTATGCAGTGAGAACACTGAGAACCTTGTTGCTTACGTTGAGCCGTT
GATCCTTTAGACCCGAGCAGGAACTGAATAGGAGCGTTTGGAAACGTCCAAGTTGTTCCTGAGTCGTGTGGTCCAGCTTCACGATGTCGATGATCTCTGG
ATTGTCGTCAGCGCTCCAGCCGCTCAAGACTCGAGCAACCTTTCTGTCCTCCCGCGCTGTGTTCGTGATGTACGCGAAGGCTTTGTTGGTCTTCGTCATA
TCCCATGCGCCGCGGTCAAAGATCCACTGGGCAGCAAGACGGTCATCTCCGTTTGCGTGCTGGGCTCCACCGCGCCGGAATGAGTGGGAGGTAAAGTCGG
CAGCTGCTCCAGCCGGCTCAGCAACACGCTTCAGCATCCTGTTCACGTACGCATGCACACTGTCTTCTCCCCGCTTGGGTGTCTTCTTCTGCGTTGAAAC
GGTTGTGGTCTGTGTCTCTGTGCTCGTAGGCGGAGTGAAGACGGCGGTAGCTGGGGAACAGCTTGCGTCTAACGATACCGGCAGCGATGCCGCCGCGGGC
AACACAGACACTTGCAGGGAGGCAAGTTCGACAGACAGTAAGTCATGCAGCGGGGCACCCAAGTCGAGCGGCATCGCGTCTTCCGACACTAGTTCTGGGA
GCTGGTCGAGCAGCGCTGCACACGGAGAGTCCTGCGTCGCCAGCGCTATAGCCAACGCATGCAGAGGACACGTCAGGAAGTCGTCCTTGTCCGGGACCAA
GGTGAGTCCCTGCTCTTCTGACGTCTTGACGCGGAGTAGCCGAAGGTGCCATCCGCTGACACTGACACGTGCTGCTTTCTGATATAGCCCAGATCCGAAG
ATCGTCCAAAGCAATGCCTCATCACGCATGCAAGTGCAGCGTCTTGGTAGTCAGTATTGACTCGTGCTGTGCTGTACACATAGCGGGTGAAAGACTGTAA
ATCCTCCTTTGTACAAGGAGGAGCTTTGGTAATTAAGCCGCTGTCGTGTAGGAACACGCCAGAATTATGTCTGCTAGTACTCCCACCCACAACACACACC
TCGCCCTTGAAGACGAGGTGAATATCGGGCGAAGTCTCGACCTGAAGGCCTTGATTCAGCCCTAGCACCGGGTTGGTTAATGACCCTGCGCACTCCGACT
TGTCGGTAGGACAACCAATCAATACAACAGCACTAGCCACGAGCACAGGCTAGTCTGCAACACACACTAAGTCAAACCTCGCTGGCCCTCAGAAGGAAGG
GTCCAGGACTTTTCAGCCGGTAAGCGAGGGGGCCGGAACAAAGCTCCGGTAGGTAGATAGATAGGAGGCTTCTGTAGCACTCCTAGGTCGAACGAGCTCT
CTCGTTCTCTGCAACACGCAGCAAATCAATCACACAATCTCTACTTCTTGGACTTGCCGGGCGGATGAACACTTGAGTTATCAGCTCACGAGTCCACCGG
CAGGCATAATCCTGGCGATCAAGCGGGACCAGACACTACGGACACTTACCGTAGCCGGACTTGACTCTTGTGCGATCGGGAGGAAAATCTGCTCTGTTTG
TTGCGCCTTGCGGGCGCTTATCGCTATACTATGGTTTCCTATATCTCAATACAAATATCTAGTGTGAACTCGTCCGTTGGGAAACTCCTGGATTCCTGAC
GACTGCTCAGCGAGGTCTCAGGAGGCGTATCCGGCATATCTCCCGGATGCGACTTCTCTTCAAAGGGCACGACTCGGATATCTTCCCTGACATGACTCCT
CGTCAGGCCGTAGTGTGCCGTACATCACCTCGCTCTTGTGCCTTGTCATTCTGCCGCGGGTCTTCTAGGCCAATCAACGCCCTGTCGCACACTTCCCCCA
ACGGGATTCTGACGACCAGACCTCGAAAGCAACGGCGGCCACGGCGACGGCAGCTCCGGTCAATTCACTACACCACAACTGCCCCCGCCGCATCGCGAAC
CACCGCACCTGGCGAGCGTTGTGGCGCGTCGAGTGCACTCCATGTCCAAGCCCTCTCCTGCGCTTGAGTCTGCTCGGATAATTGCACGCCGCATGGGCTG
GCCTGATGCGACCAACGACAACTCGGTACGTTCTTGTTCCTCATCGTTGGCGTCGCTTGCTCCGCTATCTCGAACTCACATGACCTGCTTTGTTTTCGCT
GTTCTGCTGCTCGCGCAGAACTCGGACTCGAGTGCAGCAGTTTCTTCCGCTGGTGCTGCGCACACTCCAATTGCAAACGAGTCCTCGTCTGCAGGTGCAG
TCGTGCCGTCATCGGCAGTGATGACTATGACCCATGCTGCGACTTCGTCAACAGCTCTTGTTCCGACGTCAAGTCGTGATGCAACCCCTGACAGTACACA
GCAGTCGGTACGTGTTGCACCAATTCTATCGCCACTCGTCACTCATTTTGACATGCTTGCCGACTCCTCGTTGCGACTGTAGACATCGGTATTGACGCAT
CTGCGCGCACCTCGACTAACCGAGATCGAAGGCACGGCATTGCATGGTCTCTTGATGGACGCCTCGGAGGAGACATCCGACAGGCTATCAGCGGTTCTTG
GTTCGCGACTGACCGA