Description :
From Genome Similarity Track
Location :
Scaffold_164:14189- 18561
Transcript NameFunction/comments
Pytiw_DAOMBR242034maker-piw_contig_164-fgenesh-gene-0.1Kinesin motor domain containing protein
Pytiw_DAOMBR242034maker-piw_contig_164-fgenesh-gene-0.2Kinesin

Sequence
4372 bases(100 bases per row)
CGTCGGATCTGCTCGAACGCGCCCTCCCAGACGCGCTGCCACTCCCACTGGTCATCGCTCTCGCTCGTCTGCACCTGCTGGCTCTGCACTCGCTTCTGAC
AATATTGTACACAAGACTAAGAGCGTCAGTCTGAGGTCACCAACACCGGTCAAGCTAGTGCTCAAGTCACGAATCTCTACTCTTGATATGACTCACTGGT
GGCGTTGACTCGCTCTGGTTATCGCTTTGGCCATGGCAATCCATCTCGAGACCACTCAGACGCCGTCGAACGCGGTCGGAGCTCTTGATACTGGGTCTCA
TCTTGGTGCGCACGACCTAATTACAAGTCTGTGTGAGTCTCCCTCTCTCACAGCCTGAGCAGGATCGTATCAATAACGATAGCAAAGCGATACCATGTGG
CGAGAAAGTGTCGATAGCGGACCCTGTGGGGGCATCTTGGTGAAGGGCTCGTCCAGCGCCTACCCAATGCAAACATCATAGCCACACACTCAGCCCAAGA
ACTCAGCTTGACGACCATCAAGCAACAACAAGTACTTCGTACGCCATGCAGCAGCATCTGGAGCAGAGCAGTGGCGTGCTCAAGCACGTTCTTCGTCCAC
GTGGCGTTGGTCGTGGGCTGCGCGAGCAACTTGCGCACCCAGTGGCTCACGCGGATCTGCTGTTGTTTGCTGGTTACCACGCGCGTACTGAGCTCCTGGA
CGCGCGCGAGCGTGTCCCACAGCGCGCCATTTGAGTTGGCCTGGCCAGCGCTCATCGCTTGAGCTGGCGGCTCGAATTCAGACTGGACAGCCGCATTCAA
GCTGTTGGTGACAGGTCGTTTCGCATTGAGCTCCTGGATTTCAACAAGCGGCTCTTGAGTCACTGCTCTCGATTAATAACCAGAGCTGGTCCAGTCGAGA
GCGCAGGATGGACCACAAAGTGACCACGGACTACACGCGCTTGCTGGGCAACGCCAACGTCAAGGTTTATGTGCGCGCGCGGCCGTGCGCCGATGGCCAA
AAGCCGCCAGAGGACATGTTTGAGCGCAACAGAGACCCGCAGAAGAACCTCGTGATCAAGGTGCAACTAACTAACTGCACGGTGTTTTGAGTGAGCTCGA
CGACTCAGTGAAGAGTCCGTTCTAACGTGGTGTCTACTGTTGTTAGGACACGGAGCGGATGCAGTACGGTAACCACGCGTTCAGCTTTGACAATGTAAGC
CAGCTCTTGTAGGTCACGCTAGCCTGGAGCCTCCAGTGAATGAGCAATGTCCTGTCTTAACGCCTATATTGCGTAGATCTACTGGACAGATACGTCCCAG
ACGACGCTCTTCGAGACGGTACGAGTCCATTTTTCATCGCCGTCAGTGTCTCTCGGCATAGGCTTTGGTTGTGAGTCTGACTGTGAAAGGGCCTTCCTAT
GACGTGACTATTAGACGAGCAAGCCGCTCGTGGACTACGCGGTCAAGGGCATCAACAGCTGCTGCTTCGCCTACGGCCAGACGGGATCTGGCAAGACCTT
CAGGTGAGGAGCTCATCACAACGTGTGTCTTCATTGTAAGAAGCGTGGTGGCTGATGGTATGGAGCATTTGTCTGTGTAGCATCTTTGGCGAGAGCGGCG
AGAAGGCCGGGCTCCTGTCGCGGTCAATCGAGTCGCTCTTCGAGTACGTCGACCGCAACGAAAACAAATCCAAAGTACGCACGTGATCCAGTCCCTCAAG
CTCCATTTGTAAGGCTTCTTCTGACGGTGACTGGCTTGAATGTTGCAGGAATTCACGCTCGTGGTGAGCTTCTTGGAGATCTACTGCGACCGCGTGCGCG
ATCTCTCCCGAGAGTACGCTTATACCACATGAATTATGACGAGAGACTGATACCTAAGCCGTTGTGAAACTTGTATGTGCACTAGCTACCTGAAGAAGAC
TGGGCGCTCGATCTCGTACCAGACCTCGAGCAGCACCGAGTGGTTCCTTCGCCAGGTACGACCACCAAATTCCACCATTTCCAACGGAGGTCTCAACAAA
TTCATATAGAACTATTCTCCTAATATGTGGTGTGAGTAGCAGCAAATGCTGCGCACTGAGAGCGCTTCGAGGTACGCCTTGACATTAACAAATCTCATCA
TTTGCTAAGCTATAACCAATTTCTAATCCTCCACACTTCGTCAAGTTTTGGCTCGAGTTCGGCAGCCCTGGCCGCNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAGCGACGAGGAGTACGACTACGAGAAGGCAAAC
TTTGAGATCCACGAGGACGCGCAGGGCAACGTGTTTGTGAGAGACCTGGCGATGGTCACGGTCACGTCGCGCGAAGAGGTGGATGTTCTCGTGCAGTCAG
GACTCAAGCTGCGCGCAACCCACGAGACCAAGATGAACGCCGTCTCCTCGCGCTCGCACACAGTGTTCACGATCCACATCTTCCAGCAGAGTAAGTACTC
ATGCGGCCGAGTACTACATGAAATTGGTTCGTGTACATGTATTTAAATATCATTGCAGTTCAGGAGACTGGCGAGGTGATCTATGGAATGCTCAACATGG
TCGACCTCGCGGGCTCGGAGCGGCTCAAGAAGAGCGAATCTGACGGCCAGCGGCTCAAAGAGGCGCTGCACATCAACTCAAGCCTGAGTGCCGTGGGCAA
AGTCGTCATGTCGCTCGACCCCGAGAGCGGTTACAACTACATTCCGTACCGCGACTCGAAGCTCACGCGGCTGCTGCAGAACAGCATCGGTAAGTATATA
ACAACAGCAGGATGTTGCTCACTATGGCTTTGGCCTAATGGATGGCTGAACTGTGGTCATGATGATGTGTTGTAGGCGGAAACTGCTTTACGATCCTCAT
CGCGACGATCCACCCGATGAAGGAGCACTACGAGGAGTGCCTGGGCACGCTTCAGTTCGCGAACCGGTGTCGCTCAGTCCAGAACCAGGCAAGTGAGGCT
CAGATCTTGGTTGAATATGGTATTATCTTGCTCTAGCTCACAGCAATCTGATGCCTGGACAGCCCCGCGTGAACCACATCAACGGCTCAGTGGCTGACAA
GGACCGGCGCATTCGCAAGCTCCAGGACGAGCTCGCGATCCTGCGCCGCCAGGTCGAGGGACTGCGAGCCGACTACAACAACAAATTCGTCGCCGCGCTG
AATGAACTGGGATTTGACGCCGAGGAGATCACGGAGAACGGCGAGATCAAGTTCGCAGTATGTATCTTTACTTTTCTTTTTTCACCGACAATTTCCATGT
TGGAGTACTGAAATTGGTGAAATTGGTTTTTCGTGACAACTTTGTCAGGATGGACTTGTACTCCGGTCCGTGTTCTCAGACACCAAGGCGGATGATATAC
TTGGAGTAGAGAGTGGGTTGGCGCTCTCGCCTGGCCGAAAAGCAGCCAACCAGTCGCAGGTGCAGTTCACTCGGAAGGCGAACGGTGCGAGCAAGAAGGC
CTACTGCTTCCTGATACTGAGTGTGGTCTCGGAAGTGTGGCTAACCTGAAGATTACGTGCTATAGAGATGTCGAAGAAAGACCGCGATCACCTTCGACAG
AAGTACGCGAACGCCAAGAACAACTTCACCATCGTCGTGGTAAGCTGCGACTGCTGATTCTCGGCTTCGTCAATGAGCTAGCCTGGGTTCAAAGAGCTCA
GTGATTCGACCTTGTGCCATGCTGCAGACCGAGGCCAAGAAGGAGAAAGAGGAGTCGCGCAAAGCCATGGGCGACCAACGGCGCCGCATCACGACGCTGG
AAGACGTGGTCGTGCAGAAGACGAAGGAGTTTGAACGTGCTCTCGCGGCGGAGCAGGCGAAACATCACGCCGAGATTCGCGACTTGCTCAGCAGCAGGAA
CCCGTACGACGACGACCAGCAGCATCAGCAGCGCACGATGTGGAAACGGTCGGCGTCGATCTCGAGTCTCAAAGCAGACACTGCGGCGGCTGAGAACGAG
AGCAAGAAGCGTGAGAACCGAAGCGAGCAGGTACAGAGATCTGAAATTGTTACCTTGGGTGGTGGTAATGAGCTGGTTCTCATTGGCTTGTGGACTAGAA
ACTCCTCCAGCGGGTGGCAGCACTGCAGAGCTCGAAAGAAGACGAGATCGCGCTCATTCGACAGCACGTATGAGTGTGCGTTCCGTGCTCGGCCTTGCCT
GTCAATCTCTCGCTTTGACCGCGTTGTGGTGTATGACGTCATTTGTTGGCTGGACCAGTTTGACCAGATCCT