Description :
From Genome Similarity Track
Location :
Scaffold_11:141841- 146833
Sequence
4992 bases(100 bases per row)
TGAGACAGCAGCAATTCAATGCTGCTGTGGGCGGGACGACACACACGCGTCGTCCCGAAATCTTGAAGGTTGACATCTCCAAGTACAGAGGATTCGAGGA
AGACTCCCTGTTGTTATGGCTCGTCGAACTAGACAGAGCCATAAAGGCATGTCGTATCGACGATGATTAAATGAAAATCACATTTGCTCAATTTGGTGGG
ACGCGCCAAGACTTGGGCCTTAGGGCTGGAGATGAGCGACCCATATGCTTTTGGGTCGCTGGAAGCCTTTAGAACTCGACTCAAACAGACGTTTGAGCCG
CCACGGGCTGAGTTCAGGGCTCGATCGGAGCTTCTGAAACTCAAGCAGGGTAAACGTGATGTGCACACTTACGCTCAACAAATACGACTCCTCGCGAGTA
GTATAGTTGCTAACCCAGTACATGAACACACGTTGATTACTGTGTTCATGCAAGGGCTCGCAGATGAGCCCGTCAGGGACCACCTGTTCCGCTTAGAGTT
GGATACGCTTGAACAAGCAATCTCAGCTGTGGAACAGGAGGACGTTAGCATGGGGCAGGCTCATGCTAGCTCGAGCTCTTATCGTGCACCGAGACGACAA
GAGACTGGAGGTCCAGAACCAATGGACCTCTGTTATGTTGAGAGCGAGAGACCTCGGTCTTCAAACAACAAGCGATTGCAGAATTGCAATCGCTGCCAGA
AGTTGGGACTATACGCTTACGAGTATAGTTCCCCACGCCCAGCACCAAACAGTACAGAGCGAAATGATCGGTCATTTGCCAAAAAGGACAATGGGCTTAG
GTCCAACGCTGTTGCGAAACCGCAACAGCGAAGTGGACTATCAAAAAATGGTCGGGGTCAGTAGGGGCGGAGCGCCCTACTGATCCAGCAACCTCAAGAG
AATTTGCAAATCTCTTGACGAAAGTTGCTTCAGGTACACAATAATTGTGTGTCTCTGCACCTGGTGATGAGTTATCACTCGTCACCTTGAAGTTGCAAGC
GACAAATGATTTGTCACTTCGTGCTCTAGTCGACTGTGGGGCGTCGAAAAACTTTGTTCGTCGTCAGTCGCTAGAGGGTCGTAGGCTCAAGTTCGTTAAG
CGCGACATCCCTCAAACGATGATGACGGTGTGCCTTGCCACAGGCGCGTCGATAACCGTTGAGAAACGTGTAGTTAGAATCCACTACACGTTAGAGGGTG
AACAGTACGATGATGATTTCATTGTCCTCAATCTGGATGACAAATTTGATGTCATCCTGGGATTACCTTGGCTCAGAAGATACGAGACAAGAGTGATCTG
GCAGCATCGAACCGTGAAGATGCCTGCCGCTTGTTCATCAGATGGCCATCTGGTGAACGTCATGGAGCGTCCACAAGCGTGTGGATGTACTGCGAGTGAG
TGCGATGGCCTCACTTGCGGTACGGTCGTTAGCGCGACTGCACAAGACCTCAGTGCAGCTGATCCCTACGCTGTCGAGCGAACTCCCGGCGGCTGTACAG
AAGTACAGGCAGCGCCGAAGGTCCACCACTCGAATAAGTCGAGTGGACCGGGACATGGATGCATGCCTAGCGGGAAACATCCTAGGAAGAAGAAACCAGT
TGCCACCAAAGGGCAACACGGTCATCCTAGGTCGACTGTAGAGTCGACCGTAGAGGATCGGTACCTGACTGTGGTTGCACAGCCACAGTCAGAAGACGTC
GAGGGAACAAGTCTCCACGTACTTGAGGAAGAAATTTCTCAAGAAGTTATTGGTGAGGAAATGAGACCTCATCAGCCTGAGGGAATATGTCCCCAGCAGC
CTGTGGAAAAGGGTTCCCAGGAAGAAACCGATACATTGAACGTCTTGATCAATGACGGATCAAGCGTAGGCGCTTATACGCTTGATCTGGTTATGCTTCC
GAAGTTAGCTTCGGAAATAACTCAATTGCCAACGCTGGAACCGAAACGGTTCCTGCTTGATCTGCGTAGTGGCAAGGTCAAGCAGATCTGCATACTCGTC
ACAGAGGATGAGTATGTGACCGATATTCGGTCGGCAACAGTATTTGCTGAGAACCAACGGGTTCTCAGCAGCTCATCGATGGACGAAAGTGTCCTCAATG
AGAAGACTCGGATTGAACGATACACGTCTTAATCTTGAGAATCGATTCAGGCAAATCCTTTGTATAAGGATTTGATCGAATTCAAGGATGTGCTCCCTGA
ATCCGTGCCGTGCGAGTTGCCTAAGGAAAAAGGCACTCGACACGAGATCGAGCTCAAACCGGGCTCGAAGTACTGTGTAATGAAGCAGTGGCCACTGCCT
CGTGGACAAGTACTAGCGATCGACAAGTTCTTTGCCGATCGCTTTGCAGCGGGCCATGTGAGGGAATCAACTTCCCCTACAGCTCTCCGACCTTCTGTGT
GCGAAAGGCCAGAGGAGGGTGGCGGATAGTGCATTGAGAACCCGCAGCGGTATGCTGTGGGAGTGGCTAGTGATGCCACAGGGGCTGAGTAACGCCCCTG
CAACGTTCAACAGATGTCTAACAAATCTGTTGAGACTGGTGCGGGACTTCGCACCGAATTACTTTGACGATGTGTTCGTCCATAGTCGGGCTATGAATGG
GAAGACAGACGTGAAAGTTCACAGAACACACGTTCGTCAGGTTCTTACACTTATGCGGAAGCATAAGTTGTATGCCAACCTCAAGAAGTGTATATTCGCG
GCTAGCGAAATACCACTTCTTGGGTGCATCGTGGGTAAACACGGCGTACGCCCTGATCCCGAAAAGATCAAGGCGATCACCGACCGGACTGTGCCAGTTG
ATGTCAAGGGAATAAGAAAGTTCCTTGGGCTAGCGGCGTACTTGCACAAGTACTCGCGCAATTACGCCGAGATGACTGTGCATCTTTCTTGTTTACTCTA
GAAAAATGCGAAGTGTTCATGGAACGCTGACTGTCAGCGTTCCTTTGAGCATATCAAGCAGGCTTGACGCAATCTCCCGTAAATGGCGATTGCAGATCAA
AACAGACCATTCCATGTGGTCTGTGACGCCAGCAACTTCGCAATCGGCTGTGTGTTGATGCAATTCGATACAGATGGCGCAGAGCGCGTTATCTGCTATC
AATCGCGTCAGCTGCAAGCAGCTGAGTGTAATTACCCAGTGCATGACAAGGAACTCCTTGCCATGAAATATGCACTGGATAAGTTTCGTGTCTACCTCTT
GGGAGATAGACCATTCATCGTCTATACGGACCATGCGTCACTACGCACGGCCGTAAACAGTCCACACCTCTCGCAAAGAATGGTGAGGTTGCTGTCCTTT
TTCGCGTAGTACAACTTCTCCGTCGAGTACAAACCAGGACGACTGAATGTCGTCGCTGGTGCGATTTCGCGGCGACCCGATTTCGATCCGAGCGCGCAAT
CCAACACTGCTGCGACACTTACAGTCAGTGTCCCGTCTTCAACGTTACTTGACGACGTACGAAAGGCCTACGCAGAAGATAAGGAGCTTCTGCGATTGAT
GGATCATCTGGTAAACCAACTCGTAAATCGAGAAAGATTTATCGGCTTTGTACCGTTCCTCATCAGATCGGTACACAACACACAACGGGTTGCTGTACTA
TACAGCTGTTTCCGGCGACACGCCTCGTGTCATCGTCCCCGTTCATAACGATTTGCGCTTGCGCATCATGTATGAGTGTCACGATGCCCCAACAGGTGGC
CATCGTGGTCGAGAAAAGACTTACCTTACGGTACGTCGTGACTTTTACTGGCCCCGCCAGTATCAGTTTGTACGCAAGTACATTCGTGCTTGCGAGGTTT
GTCAACGGTTGAAGCCTAGTCCTTCATCCAGTGCACCCTTACAGCCTCTACCTGTCCCGGCACAGTGCTGGCAGTCCATTTACCTGGACTTCGCCTTCGG
TTTCCCCGGAGACGCTCACAAGAATAATGGTATTCTTGAGTTCGTAGACCGGGTCAGTAAGATGGTGCATCTTGCTGCTGTACCCGAGTCGATCACGGCA
CAGGGCTGTGCTCGTGTCTTCATCGACACAATCTTTCGGCTCCGCGGGTTACCCCGTGAACTCGTATCCTACCGTAACCCTCGGTTCACGGCGGAGTTTT
GTCAATCCGTGTTCCGATCACTCGGAACGCGATTGAAGATGTCAACAGACCATCCCGAGACAGATTTTCAGACGGAACATGCAAACCGTGTCCTCGAAGA
GATACTTCGAGGATACGTCCACTCGTTCTCGAGTTGGAGCGAATTCCTCCCCATGGTGGAATTCACCATCAATAATTCGGTGCATGCGTCAACCCAGCAC
ACATCATTCTTCGTGAATGGCTTACGCCATCCGCGTCCACCCCTATCAGAGTGTGACTCTTGGTTAAGGGGGGAGGGACTCGCTCGAGCAAAAACCATTC
TGGCTCTTGCTCATCACGTGACGACGCTAACGTCGTCACGTATGATGCCGATGTCGATGTCGATCAGGTCGACATCGAAGAAGAAGATCATCTTAATAAT
AGTGATGAAGCTATAATTGAGTCAGATGATGATGCTTGTATTTTCAGCATCGCCAAAGACTGTTCCAGCGAGGGTGCTGACACCCTCGCTGACGAACAGA
AAGAGGAAAGAACAGTTCGCATAAGGCGAAGTGAACAAATCAATGTCTCGTCAGCAGAAGGATTTCTGCTGGCTCAAGAAGCAGTGGTCCGTTTCGTGCA
GGACTCCATCGCTTACGCGGTGGACCGGCAGAAACGGAACGCTGACAAGAATGGAAGAGAAAATGTTCTTTCGTTTAGTGAAGGCGATTTAGTCCTACTA
TCTACGGCAAATCTACCTCGACACGTAGTGACCAACGTGGGCAGCAGTAAACTACTGCCCAAGTACATCGGCCCCTTTCGTGTGCTGCGCCAACAAGGCA
ACGCGTACAAGATCGATCTGCCGCGTAGGATGCGTACGCATCCTACGTTTTACGTGGGGCGTCTCCGCCCGTACTGTCAATACGATCCCTCT