Description :
From Genome Similarity Track
Location :
Scaffold_58:141838- 143318
Sequence
1480 bases(100 bases per row)
CCCGTTACACCTGGTAGCACTTTGTAGTCCGTTGAACGACTATGAACATGTTGGGTGATGAAGGGTAAGATTTTCATCCAACGCAAGAGAGTTACTCCCA
TTTGAGTCAAATTTGATGGGATGCCGTCTAACGATTGGGTTCGACGATAGGGCAAGAAGCCGTAGGCGCAATGCTATCCGCTCTGGGACTATACGAGCAA
CACGCCACCATCGCCAGCTTCATTTAGAATGAACTTGACGCTGAACAGGAGAAAGTAGTAGCCTTGCTTCACCAACAAGGGTATCAACATACAGAGCTAT
TGAGATAGCAGCGGGCTGTTTCTACCGGGCTGACACACGCACGACGACCCGAATTGCTGAAGATTGACACATCCAAGTACAAACGGGCTGAAGAAAACTC
TCTGTTGAGATGGTTTGTTGAACTGGATGACGCCATAAGGGATCGTCACATAGTCGATGAGCAAATGCAACTTTCATTTGCTCAATCGAACTTGGTAAGG
CGTGCAAAGACTTGGCCCTTGGTCCTCACGACACATATGTCTTTGGGTCCTTAGAGGCTTTCACATTCAGCTCAGACTAACTTTTGATTTGCCGCGAGCT
GAGTTCAAGGCTCTCTCTGAACTCCTGAAACTCAAACAAGGAAAATGTGTACACTCATACATTCAGTACATACGTCACCTTACGAGTTGCATTGCAGCAA
ATCCGCTGAATGAACAAACGTTGATGACGTTGTTCATGCAAGGTATCACGGACTGTCGAGTCAAGACCTGCCTGTTCAGACTGGAGTTCAATACCTTGGA
GAGGCAATCCGAGTTGCGGAACAGGAGAACTTCAGCGTGAAACAAGCTCATGTGAGTTCAACCTCCTATCATCCCCCAAGGCGACAGGAGAATGGAGGCC
CAGAACCAATGAACCTCTGTTACTCTGAGAGTGAAACTCTCGCGTTACCAATTAGAAAACCCCCAGAGATGCCATAGATGTCAAAAGACAGAGCATTATG
CATTCGAATGCAGTACCACGTACCGCAGGAAACAGTAACCGTCAAGCGGCCAAGAAGGGTCCGAGGCGTGGGACCGACGCTTTTGCGAAAGCGCAACATC
ATAACGGACAATAAAAATCGGTCAGGGTCAGTAAGTGCGGAGCACACTACTGATACAGCAAAGTCAAGTCAATTTGCAGGTCTCTTGACGATAAATGCTC
CCCCACACGCAATCATTGTGTGTTACTGCATCTCGTAATGAGGTTTCCCTCAATATCTTGAAACTCGAAGTGTCAAAGGATATGCCACTACGAGCCCTAG
TCGATTGTGAGGCATCGAAAAACTTTGTGCAAGGCCAGTTGCTAGATGACGGCAAGATTAATTTCATTAAGGCGCAAGATCCCTCTAACGAGGATGACGG
TACGCCTCGCGACATGCGCATTAGTAACAGGGTGAAACGTGTAGTAGCGATTACCGATACACTGAAAGAAGTCCAATATG