Description :
From Genome Similarity Track
Location :
Scaffold_11:14182- 17318
Transcript NameFunction/comments
Pytul_DAOMBR144PYU1_G005161Similar to AVT1: Vacuolar amino acid transporter 1 (Saccharomyces cerevisiae)
Pytul_DAOMBR144PYU1_G005160Similar to AVT1: Vacuolar amino acid transporter 1 (Saccharomyces cerevisiae)

Sequence
3136 bases(100 bases per row)
AAACCATTCTTCACGCTCGAAGATGCGAAAATCGCATTCAATCTCTTCTGCTGTGTCTACGGCATCGGTACGCTCGGGATGCCCGCCAACTTTTCCCGTG
CGGGGCCAGTGATCGCCACGGTCGCACTGTTGTTCATGGCTTTTGCCAACGTGTACGCATCTGTCGTGTGCTCCAAAGTCATGCTGGTCGCCCCACGCTC
CGTCAAGACCTTTGGTGACCTCGGTGAATGGGCTGTGGGAAAAACCGGACGGTACCTCGTTGTAATCTCGCAAATGGGCGTCTGCTTGCTCGTGCCTTGC
GCTTTCCTCGTACTCGGTGGTATTTTGTTGGACGGTCTCTTCCCGGGTGCGTTCGAGTCTTCGACTTGGATCATCCTCATGGCGCTCATGGTTCTGCCAG
TGTGCTTGACCCCGACGCTCAAGGAAGGCGCTGGGGCCGCGTTTGCCGGTTGCATGGGAACGATCATTGCTGATATCATCGGTGTGGGGGTGCTGCTGCA
CGGCATGAGCGGTCACCCGTCGATCCCATCGCCTGCGATTTCATTCAAGCAAGTCGCCACCACGTTCGGCAACTTGTCGCTCGCGTACGGCGCTGGCATC
GTTATCCCTGCGCTTCAGCGTCAACACAGTGACCCATCGCGCATGCCGCGTATTGTATTCGTGACAATCACATTCATCTCGTGCCTTTTCTTGATCTTGG
CAGGCTCTGGCTACTCAGCTGTCGGATGCCAGATCTCTGGCAACTTGCTTTTTACGATCTACCCGAGCGCTACGACTGGACTGACTAAGCTGGGCTTCTC
GTCGGATAAAGGCATGGTCGTGCTCGCGTACCTGTTCATGCAATTGCACATCACAATCGCGTTCGCAGTGATCGTGTCCCCAGCGTTCTACATCTTGGAA
CGTCTCGTGTTGGGCATGCACAAGAAGAAACCAGAAGACATCGAAGCCAACAACTACAATGCGGTCGACACGCCAGCTGACGGCATCAAGGAACGCTCGT
CCAAAGGCTCCGTCGTGTCTATGGCAGACATCGAAAAGGAGAGTCTGGACGAAGAAGAAGAGTCTCGGGAATACCGAGGCGCGAACATGTTTAAGTATGT
CATCTTGCGACTCGTCGTTATCGCAGGCTTGGTTGTCTTGTCTGTCGTCTTGAAGAACCACTTTTTGGACTTGACTGACTTTGTCGGCGCGTCATGCATC
ACCATGAGCTGCATCATCTTGCCGATCGTATTCTACCTAAAGAAACTCTGGGCCAAGATTCCAATTTACGAGAAGGTGCCGGCGATCGTCGTCATCCTTG
TCTGCCTCGTGCTTGGGTGCTACGTGAGCTACAACACGGGCAAGGCGTTGTTCAACCCGGACCCTGCGGATCCACACGCGCCAAGTTTCCCGTTCTGTAA
GGCCGAGTTCGCAAAGGAAGTGTACTACAGCAAGACGAGCAATTCGTCGTAAATCCACTCATTCGCCCGTTCGTCCATAGTCTCCTGCTAATGTGGCTAG
TTTGCCAGCAGATAATGAAGCGTTGGTTTTCTCACTGAAGCGCTGAAACTTTTGAACTAATTGGTACGACTACGTACAAACGTGACTGATTTGTTTTTGT
GAGATACTTTATTGCTTTTAACGCGACTATCTAGAATTCCTCTTGCTAGAACGAGACCTATTATGTCGAAACCGTCGAGTTCTTGACGTAGTACGGCTTG
AACTGATACTTTACGGGGCAGAAGCCAAACACGGGCGTGTCGGCAGTGACTTCAGTGGTGCCGCCGAACAACGCCTTGCCGGTGTAGTACATCACGTACA
ACCCACATCCCGTGCAAAACACGACGAGGAGCAGCGCGATGACGCGCTCATATATTGGGATCTTCTTCCAGCTCAACTTCAAGTAGAACACGAGTGGGAG
GATCAAACAGCTCATAGTAATCGCCGACGCGCCGATAAAGTCTGCGAGGTCCAAGAAGTGGTCCTTCAAGGCGATTGAGGCCAAAACTAGGAGCACGATC
ATTACCGTTCGCAGCAGCACGTAGCGAAGAACGTTCCGTGGCCCCAAATACTCGGAGAGTTCATTCTTGTCTTCGTTCTTGCCCTCCGTGGCTACGACTT
CGCCTTGAGTTGTCGAGTCACCCGAGTGTGGCGTAGACTGGGACACGTACGACGCCTTCGTCAGGCCTTGTTGGTCTTCAAGATCAGCCTCCAAAATTTC
AAGACTTTCAACCTTGTGCATTCCCAAGATCATCCGCTCAAACATGAAGAACGCCGGGTGGAGCAACGTGGAGAACGCAATCACAATGTGCAACTGCATG
AAGATATACGCCATCACAACCGCGCCACGATCCGCAATAAACCCGAGCGAGGTTTCTCCAGTAGAACCCGAACCAGCAATCGAGAAGAGCAGGTTGCCCG
AAATCTGGCAGCCAGCAGCACTGTAGCCAAGTGCAGCGAGCGTCAAAAAGAAGCACGAGACGATCGAGAGCGTGACGAAGACAACCTTCGGCATCCGGTG
AGGCTCACTGTGTTCACGCTGGAGATCTGGAATCACGGTTGCAGCGCCGTACGCCAGCGACAGGTTACCAAACGTAGTCACGATCTGGTGAAGGCTGAAA
TCGGGGCTTGGAGGAGCAGGATGGCCAGCCATACCATGCATGATCACAGCAATCCCCACAATGTCGGCGATGATCGTGCCTAAGCATCCAGCAAACATCA
TACCGGCTCCTTCCTTCATAGTCGGAATGAGCGCTACTGGAAAAACCACGAGCGCCATGAACACGATCCAAAACGTTTGACTGAAAGCTCCTGGAAAGAG
AGTTTGGAACAACATACTGCCGAGTACGAGGAACGCACATGGCACCAAGAGGCAGACCCCCATTTGAGAGAACACCACAAGATACCGGCCAGTCTTCCCC
ATCACCCACTCGCCAAGATCACTGTAATTTCGAACACTTTTCGGTGCCATGAGCATCACTCTTGAAAGCGTCACACTCGCATACACGTTGGCCGAAGCCA
TGATGAGAAGCGCCACAACCGCGATGTAGGGACCTGCGCGTGCAAAGTTGGCAGGCATGCCGAGCGTGCCGATGCCGCAGACACAACAAAAGAGCGCAAA
CGACGCCTTGTAGTCTTCCGTCGTGAAGAACGCCGA