Description :
From Genome Similarity Track
Location :
Scaffold_785:14180- 15182
Transcript NameFunction/comments
g17839.t1hypothetical protein

Sequence
1002 bases(100 bases per row)
TGTCGTCCCGGTTCAACGTGAAAGACCAGCACCGACTCGCAGCCAAACCGGATCGTCGCAATATGCCTCAGACACATCCGAAGCGGGATCGGACAGCTCG
ATCGAGCTGCAGCGGATGACACTTGGGCCGGCCGGAGCAGCCATGCTACAGTCGCGAAAGGAGAGATCGGAAACCAAGCCGACAGTGATCGCGACGAGCG
ATCCAGCCCAAGCTCCCCCTGAACGCATGCAATCGTTCTTCAATGCAGCAATGGAGCGTTTCCTGAAGGAACAGCAAGCGGTCTCGACCACGCCAGTCGT
CGACCAAACCAAGCCACCTGGAGCTCAAGACGTTGACATGGAGTCCGTAGAGTCGAATCGCCGGGACCATTCGCACCCGAGCGAATACGATCCGGATGAC
CTGGGTGTCGACGCTGCCCCTCGTGCCGCAGTCGCATCTGCTGGGACTACAGGCGGCGGAACACTCTCAGCCACAAGGATCCGAGTCTCCGCGATCTCAG
AACTGAAGGAATTTTCGGGGAAGGACAACGACGAAGATCGTGCCAGAAGCTGGTTCGGCAAACTGAAGTCTGCCTTTGTCCGCGATCAAGCTCCTGACGG
CGAGAAGTGTCTGGTGTTTGGAGATCTGCTCACTGGACCCGCACGTAACTGGTACCGACAGCTGAGTCGAACGACGCGCGGCAACTGGAAGAGCTTGTCT
AAGAACTTCCAGACTCAATACTGCGGACGTGGCGTGTCTGTCGCGAGACAATACTACCATGCGCGAAAGCGATCGGATGAATCGCCGCTGGAATATCTGC
ACCGTCTGAATGTCGCTGGTTTGCGAGCTCAGCTCTCGATCAAGGATGGATCGATTGAGGTCCGCCGTGAACATGTCGATCACTTCATCGAAATACTCGA
CGATCGCGATCTAGCCAGCCAACTAGCACTGCTAAGAATTCCGGACGCAGAGACTCTCGAAGAGACACTGCGATCCCGACAACGTGCGAAGGCGAGACAA
GG