Description :
From Genome Similarity Track
Location :
Scaffold_62:141790- 144004
Transcript NameFunction/comments
Sapdi_VS20SDRG_13663hypothetical protein

Sequence
2214 bases(100 bases per row)
ATGGCCTTGCCGCCAAACTCGCCCCTATCAAAATATTAGATAAAGTATCCACTCGATCCATTGAAGCGTACAAGAAGAGGTTGAGAATCGGCTTGAGGAG
CGTCGACGTCGGCATGGCGTACTCGCCGACTTCGCGCCGTTTTTTGCCCCACTTGGCCTGCAGGTCTTCGGCGTAGTCGAGGTACGTGGCGATGATTTCG
CGCCGGGAAAAGCCCGGATTCTCGCAGTCAAAGAGCAGGCGATCCGCGTCGCGAAAGTTCCACGGGTTGTTGTACGCCGCGCGGCCAATCATGACGCCGT
CCAGGTTGAGGTCCTTGTCCTACATCGTAGTATGACGCGTCGAGCATCATATCGTGTGCGCGTACCTGGAGCAGTGCGTGGGCGTCTTGGATTGAACCGA
CGCCGCCGTTGAGCATGATGTTGAGATGCGGAAAATCCGATTTCAGCCGGCCAACGTAGCTGTAGTTGAGCGCGGGGATCGTTCGGTTCTCGTGCGGGCT
CAGCTTGAGACCGTCGAGCCAACACTTGCGCGCGTGCACCGTAAAGTCCGTCACACCCGATGCGGCGACGGTCGACACGAAGCTGTGAAAGTGCTCGTAA
CTGCGCTTCAATATCAGGCTCGGTCCATTGGTCAACAAACGTACGAGTCGAGATCGTCGACACCGATGCGGCACTTGACTGTGATCGGCGTGGACGCAAC
TTGCCGAATCATTTCGTAGCAAAGGTCGCGGACGAGCTCCGGGTTGAGCATAAGGCGCGCGCCAAAGCACTGGCTCGACACCTTGGGCGACGGGCACCCA
ACGTTGAGATTGATCTCGTGAAAATTGCCGTAGGTCTCGGCCATGCGTGCGACCGCTACAGCGTTGTGAGTCAGTTGTTCTGGGATGAAGGGCAGTCGTA
TTACTCCCGAGGCTCTTGACATCGTTGCCGCCGAGCTGGAGCGCCAGCGGGTGTTCAATGTCGTCATGACCGAGAAAGTAGTCCAGGTTGTCCTTCTGGT
GCAGAAGCTACGGCGGTACAGACATGGCATCGTGAGCGCACGCAAGATTCACGCGTCAGTACCGTCTGATCGACGACCATCTCGGTGTACAAGAGCGTCT
TGCGTGTGATCTGGCGCATCATGAAGCGGTAGTGGCGGTCTGTCCAGTCCATCTAGCGCGATAAGATGAGCCAAGTACGCTAGGCATATCCGCGGGTCGC
ACCATGGGGGCCACCGAGAGCCGCGTCGGAGCATAAGTCGATGCCATTCGTCTCAAGAGCATGAACCAAGCTCGTCCGTCGCCTTGTTATTGGGAGAGGG
CCAATTGCTGCGAGCAAAATCTCTACGGCCAATCAAAACCTACCCTCAGGTTCTATGTCCAATCATACGTGGCAAAACGACCTTGCGCAAGGCCATTGGA
TAAAAATTGGTTTGCGATCCGCCCACGAAAGCCTACTTTGTGGAGGTCGCTGGGTCGTCTCGTGAACCAAGGAGCTGTACCCAAGTACTATTGTACATGT
TTAGGATGGGATGTCGTACAGAGTATTTTTCACTTGGTCCCCATTTTGGCGATATATTATCAATTGGTCCCCAACTTTTTGCCAATATTATCACTTGGTC
CCCAAGACATTTGATTGGTCGAAATAGGCCAAATTACGAAGCTGATTGGACGGAATCATAGTAATTCCTGCAGCCCAGCACGGTTGCCCTTGCACTAAAT
AGTGTCCAGACACGTTTAGCAGCTCACACTATTTGATGTAAATATAACAAATAGTGTGCGTGACCGGGTAAGTGGGCCATTTCGAAGGTACCCCACCCCA
CCAGACCAGGATGGAGACCAAGCGGGTAGTAAACGTGATGCAAGGCAATAAGAGGCGGTGAAGCCAAGTGTGTTGGATACGAGGGAAATGCTAGAGTGAG
CATCATGATCGCTAGCTATCCGCGAAGAGCTATCGGGTGGCCATGAGGCACTCTGTACAAATGCACATACTGTGTCGTAGTTGTTCCGTCTATGAGGGAC
AATAGAACAGTTTATGACCCATCCGTCTACTGGTAAAACAAGAGCGTCCCTGAGATCTCCTATGCGGTAGATCTCTCGGTTATGCTAGCCGCCTGGTTTG
TCAAACCCGGGCTATATGACATGTGCGTGATCGTGTTTCGCGTTGTCTTCATCTATAAAGACTTCGTACACATAGAGACTAGCAACTTCCTTCTTCATCA
TTTGCTCGCCGGGC