Description :
From Genome Similarity Track
Location :
Scaffold_664:14174- 16510
Transcript NameFunction/comments
Pytve_DAOMBR484maker-pve_contig_664-snap-gene-0.18Conserved gene of unknown function
Pytve_DAOMBR484maker-pve_contig_664-snap-gene-0.11Gene of unknown function

Sequence
2336 bases(100 bases per row)
CGGTGGTGGCGGTCCGGGAAGCACCGGCGGCGCGAATTGCGCGAACGAGTCCCCAAAGCCAGGAGAGAAAAAGCGAACGACGTCATGTGGAGCTGTGCGC
CAAAATGTCGAGTTGTTCCACGGCAATGCCGTGTCGGAGTCGGGCAACTCGCACTGCCGTGAGAAATCCCAGCCAAACAGCGCCGACGTCGACGCGTACA
CTTGCTGCAGTTGCCATTCGAGCTGCGTGTCGTCCTCGAAGCGGCGCTGCTTCGCCCACCGCGCCAAATCCGGATCTTCGTCTTCGTCGTTGTCGTCGTC
GTCAGTTGATGGGTCCTGCGCCATCCGCCCAAACGCGTTGTCGTCGTCGTGAACTACGTCTTCGTGTGGAACGCGAATTATATACTTGTCCAGCTTACGT
TTGCCCGTCATTGACTGTAGCTGCGGTGGCGCTTGAGGATGGAACGCCGCTGCATTCGGATTCAAGACCGATCCAGTGTTGTCAGGCTCCTTCTCTGGCT
CGGTCTTTTCGGCCACTACATTTGAAGCGCTGGCTCCATCCAATTCCACTCTTGCCGGTTCAGGCTGGGGCTCGGATTCATCAATACCGGCCGCGACGCT
GTCGATTAGCGAAGCATCCTCTGTATCTTGACCCTGTAGATCAATGATTTCGTCGCTACCTCCGGATTGAACGCCACTTTCCGAAGGACATGACGATGGC
AGGGACTTGAGAGCCACAACGCCTTTGGATTTCTTCTTCTTTTTCTTCTTCTTGCGACTGTTGTGCAGAGCCTGCATGCCTTCAGCTTCACAGGACTCTT
CCAGCAGGAGCGCTTCCATTTGCTGAGTCGCCTGTTTCTCCAGGTACACAACGTAGCTTCGCAGGATGAGCTGCAGAACCAATTGTACCTCGTCAGCGAA
CTCGACGCCATCTCGATTGTCTGTATGCACACGACGCGCACCTGTTCAACAAGCATCGCAATGAGGCGCTGGTAGTCCTCCCACGTGTTGATGACTTCGC
TCTCGGTGACGAACAGGTCGTGGAATTGTTGCGCTGTCAGCACATGCACCGATGACAGGAAGCCCGTCAGGGCATCGCCCACAAGCGAAAACAGTCGCTC
CGAGCTCTCCACCAGCTCGTTCTTGACGGTCAGGATGCCTGCAGGTAACCATCAGCGCCACTATCGATATCGATCCGGGAACAGAGTTATTGACACTCAC
CTGTGCCGATATCCATGAACTCCATCGCCTCCAGCAACTCGTACGTCTTCTCGGTCGGATCATCCGTCGCGGTTGGCGCCAACATGGATCGTGTAGGCGA
CGATCCAGCCGCCTTGTTGGCAGTGTCCACACTCTTAGTCGTTTGCAGCTTGGGTTGTGACACTGAGGCTGCAGATGCCGGTGCCGTTTGCCTCTCGCTC
TGTGCCGTGGCCGCTGCTGTCCGCGCCTTGAGGTGGCGCTGCATCAGTCCCACGCAAAGCAGGCTCAGATTGAGCTTATAGAGCTGCTTGACCAGCTCAG
GGTCGTCCAGAAACAGCACTTGCTGCCGCTCGCTGGCACTCAGCTGATCCCAGTACTGCCGCACGCGGCCCGCGCTGTTTCCCGTGGCGATCGTCGCCAG
CGGTAGCTCCACGAGTTTGCCAGCGGCGACCGACGGCTTACCTCGCTTCATGGAGCGACTGCTAGTGCTCGAGCGGTCATGTGGCAATGCGGGTCGCCGC
TTGTCGACGCTTGCGCTGCGAATAGCGAGGTAGCTTCTCCAAATTGGTGCTATCCTCACACAGCACGGCATCACACAGCCCGTTCAGTCAAGGCCACAAC
ATCCAACGGCGGCGGCGACGCCTGGCGATGCCGAGTACGAGATCTCGGGCTTACCATCAACTGCGACGGCCGCCTTCTTGACGGCGGTGGCGCGTCGCAT
GGCCGCGCCTGCCATCGATCGATTGATCTCGAATGTGCCTGCTCGCGTCCATGCTTTGACAAGCTCCAAATAATTGGCTCCCCGGTAGTCAATTATTGTA
TCAGTCAGCCTGCATTCCAGCAAGATGCCCATCATTCCATCGTGACCACCAAGGGAAACATGGCCGACGCGCAGCATCGGCGCGTGGCGCAGGCGCTCAA
GGCGGCGTGCGAGGAGACGGCAGCGCAGGCGATCGCGGCGACCACGGCCAGCGGCCAGGCGTCGCGCGTGCACCACAAGAACCGCAAATTCGGCAGCCGC
AAGGAGGCCATGGACGCCAAGGTACTCCTGATATTCCATCATATCGTTTAGTGGAATCAGCGTGGTGATCGTCCATTTGCTGTCGCTCGTAGATCGCTGC
GGCCAAGAAGAAGCGAGAGGAGAAGCAGGCCGCAGC