Description :
From Genome Similarity Track
Location :
contig_16:141729- 144298
Transcript NameFunction/comments
g4214.t1hypothetical protein

Sequence
2569 bases(100 bases per row)
TCGAATGCCTGACATCTTACTCCTCCAAGACACACAAATGAAAACAAACCCAGAAATTACGAATATGACGAACCAATGGCAGCGTGTATGGCAGGTAACC
AAATCTGACAACGACATGAGCTACTGGACACAAAATAAAACAAAACCAGCAGGCCTAGGAATTCTAGCCAGCCCAGCCATCAGCGCACGAATAAAACCTT
GGTAGCAAGCAAGGTGGACATCACGTGTAATAGCAGTGGAACTAGATGACTGACTAATAGTAAATGTATATGCACCAGCTCAACGAAGTGAACAAGACCA
ATTCTACGCCGACCTCGAACCTTGGATATCTCAACACAAATCTGTGATCATCGGAGGAGACTACAACTGTGTACTGACACCACATCAAGATCGCATAACT
GGACGCAAGCCCAGCTCGTCCCCGAATGAAAGCAAAATACTTCAAACGATGCTGGATAAATGGGATTACTCCGACGCGATCAGCCTCACCAGACACCTCA
ACGACGAGGAAGAAGACCATGACCCAATGCATTTCTACACATGCTGGGCCCAAGATGGAGCCAGCAGACTAGATCGCTTCTACGTAAAAGGTGAACCATT
CACAGCGGTACAGTGGGTTGATGTAATAACCGCAGCACACGACTCCGATCACGGAGAAGTACGACTCGAGCTATCCACAGGAAAGCAAGCCCCACGAACC
GGAAAACAACAAATCCACTACACAATCCGCACAGGACGACCCACACGTGTACCACAAGCAATAGCCACCGGCTTAGCAGAGGTAATGGAGTGGTTTCAAC
AGGCAACCAACGCTATTGAAACATGGGGTCACATCACAGAAGAAATACGACAACTACTACAAAAAGTGAAACGACATGATGACAAACAAAGTCGAAGATA
CTTTGAAAACCTGTGAGCATCAACAAGAACGGTTAGAACAACTAGAGCAGAGATCCATGAAGCAGATCGAAAAAAAACACGAACCAGAGCGGCAAGATCC
TTCGGACAACACCTACAACTGACAACAGAAAACACACGGCGCCTTTTCAAACTAAACTCAGACTGCCAACGGGATCAAACAATCACAACAATCGACTCGT
CACCTGGACACTTTTACGCGGATGAATACCCAGTGGAAGAGAGAATGGCGTCCGAGTGGAGCCACGTCTTCGGACAGTCTCACGCAAAAGTGGAGCCAAA
CAGTAGAGAAGAGACGTTCAAACAATTTGTTACCATCCCCGAAAGCCACAAATTCACACCAGCAGAAGCCGAAAAACTAGTGAAGCAGATCTTGGAAGGA
GAAACCAGAATGGCGATTGAACACCTAAATAGGAACAAGTCAGCTGGAACCACTGGACTAAATCACGATTTCTACAAAGACTTTCAGAACGAACTCACAC
CAGGACTCACTAAACTTTTTAACGCTTTTCTGGATGGAGCAGGGTACGTACCACAAACGTTCCTAGACGCGACCGTAGTCCCACTTCGGAAAAAGGGGGA
CTCAGCGGAAGCAATGGACTACAGACCAACAGCTCTCCTCAACACAGCATACAAAGTTTTCGGGCGAATATTAGCAGAACGACTACATCAACTTCTACCC
AAATTAATTAGTGCAGCGCAGCAGGGGTTTGTCAGAGGACGATCTATCGACAAGACAATAACCATACTACGAGCAATACTAGCAGAAAGCGAACACAACC
CAACCAAAGCATGGGCAGACTTTGCGGCAGTACTAAGCTTAGACCTACGGAAAGCGTACGACACGCTAGATCTGGCATTCCTCCTCATGGTCCTGAGACG
ATATGGATTCTCGGAAAGGTTTATAGCAGTGATACAGCGACTACATAATAGAACGACAGCGATCATCTTCTTGGTTAACGGGCAGTTATCAACTAAATGG
ACAGTGGCTTCGGGCATCAGACAAGGATGTCCTCTCGCGCCACTCTTGTTCATTCTGGCGGTTGACATGCTCAGCAGAGTAATCAACCAACATCCAAACC
TAACGGGATTAGCCATCCCTGGCAGCAAAACGCTCCACTATAAATTCTCAGCATTTGTTGATGCAGCACAGTGTACTTGAAATCAGCGAAGGAAATACCG
ATTGTACAGAAAATCCTGAAGGCGTTTGGGGAATTATCTGGACTACAAGTACAACCGCAGAAAAGCGTACTAATAGGATTGAACACGGCTGGGACTCCTA
CGAAATGGCATAGATTCCTGGTGTTACAACCAAGAAGACAACAAGATATCAGGGGTACTGGGTAGGAAACTCAGATCCAACCATGGAGAACTGGAATATT
CGGATCTAAAAACTACAACGACGCCTTCGAATCGCGACCACGGTGGGCAACTCGGTAATACAACGCATAACGCTCTTCAATGCAGTTGCACTGCCAGCCA
TACTGTACACGCGCAAACAATATGTGCCACCAAAACCCGTAATTAGTAGACTCAAAATATGTAGAAGCAAGAACAGAATCCAGCAAGCTCAAAATCAATC
CGGCACTGCTACTTACACCCAAGACAGCAGGCGGTCTCGGCCTACAGGACATAGAGAGAGCCCTCAAGG