Description :
From Genome Similarity Track
Location :
Scaffold_86:141725- 143936
Transcript NameFunction/comments
g7124.t1hypothetical protein

Sequence
2211 bases(100 bases per row)
GAGGATACGTGTGGAGAGGGCTCGAATGCTGCGAATGCGGCACTACCAGACCGCTCCGTCGTTGCCGTCCCCTAACCTGTCACCCTGGATGTTCTTGTGG
TATTTTGGTACGGACGTGAACTTCATAAACACGACGGGTCTGTGCCGGTGAGTCTCCTGCTCATGCCGTATGATCTCTATATGCGGTCCAAGTTACTGAC
TGTGGTTTGTCTGTTCAGGCGGGCCTTCATGCGGTTGTTATCTCGATTCGCCCTGTTCTATGCGATCCCAGCGTATCGCCGCAGGGGCGGTCGGCCTCGC
AAGCTCCAGCACCATCACCAAGTGTTGGGGCTGTTGTTGGCCTTCTACGTGGACTCGATGGGCCAGAAGGGCCTTTGTTCAAAGTTTGGCGTCCCTCCCG
CAACCTTGTGTAGAGTTCTGAACGATGCGGAGATCGCCATGAACCGCGCGCTGATCGGCTTCTTGCCCGCTCGTATTGTGTGGCCCTCGCCTGCGAGGCA
GCGAATGCTCGCTCGCCTGACGGCGGCTCGCCATCCACTGTTGCCCTTCACATGGGGCTTTATAGACGGCAAGAATCTAAGGGTAACTTATGCGATGTGT
GCATTCAGATAGGAGTGACTGATAGTTCTAACCGAGCTTGACGTGTGTGCTTCGATGATGTTGGTGTCTAGGTGCAAGAGCCCTCTGATCGGGATCTTCA
AAATGCTCATTACAATGGATGGTTGCATGCTGTTTTCGTGACCGGCACTCTTTGTTTCAGCGCGGATGGCTTGATTGTTTGGAGTAAGCATAACTACCCT
GGCAGTTGGAATGATGCAGATACGAGTCTCGAGTTCCGGGAAAAGCTCCTCGACAGGAACCTGAACCCGGATCCTCGCTACGGTATCATCGCTGACAGTG
CGTTTCCCTGTGGGGATGACATGCGGGGTCGCATCATGACTCCTCTGAAGGAGGGCGATCTGGCACGACTCATGCCTTCAGTACGCGCGGTCGCGCATCG
GAAATCGAAAGCAATAACATATATCCGGCAGGCTATCGAGTGGGGAATGGGCTCAGTGGGCAAGGTCTTCCATCGGCTAGCTCTACCTATGCCGTACGAC
GTGCAAAAGCGCCGAATTCGACTTGACAATCTGTTTCGCCTTTCAAATTACCGCGTTCGGACAGTGGAGATCAGCCAAATACGTACGACGTTTGTATACG
GGACCGAAGACAACAGGTAGTTCACTACTTGTGATATCTATTCTGTCAACTGAATCTGAGTTCGCTCTCTCACTTAGTGCCGCGTCACTTCTTCTGTAGT
GTTGATAACAGCATCAACATCTGCTCGTGTCTTTGTCGGGCTTCGCTACGTTCGAGTGCGAGTCGTTCTTCAAATTGGCGTCTGTTCTCCTCTCTTTCGC
GCTCGAGTCTGGATTCTCTGTCAGCGTCCAGACGACGCTGCTCTTCTCGATTCTCCCGGACGATCTGCACCTCTTGCAATCTCGTCTTCTCGGCGGCTTC
CGCCTCCTCTCTCCGGACTTGCTCTCTTTCGGCCCTCTCTCGACGAACTGCCTCCAAGTGTTCATCTCTTTCCATGCGACGTCGTCGCTCTTCAGCTTCA
GCGCGCCGCTCGCTATCCTTCTGGAAGAACATGAGAAGTTTCATCATCTCCCCCGTGCTGCTGGAGCGTCTGCTCTCAGCATCATCCATATCCTTTTGCA
TGTCGTCCAGCCGTTGCTGCATACGAATCCTCTTGGACTTAGCGAAGGACGCAGAGTTGTCGTTCTTGGCGGACTCGGCCGGCGACCGTTTCCCGTTCTC
GTTGAGGAAGGACTGAGTCAGCGCCTCCATGTTATCCCGGACGACACGGAGGTCCTGGCCCCCAAGTCGATTACTGGCTACGTTGAGCGAGCGGTTTTCA
TTCTCTTCACGCTCGTCAGCTGCCATCCGACCCGGGTTTCGTTGGAGCTCTGGTCCGTGATGCGAGGCCACGGTTGGGATATGCTGGACATTTCGCGTGC
GTGGCCTCCCTGCCCCGCGCCCCGCGTTGCTTCCAGTAGCAGGTCGCGCGGAAGGCCTTGTTCGACGCGGCGTTCGCAGTGCCTCTCTTCCACCGCGGTT
GCCTCGTATCGAAGTTGTTGGGGTAAGCACCCCTTCCAGGGAAAGGTTGCTCCGCGCGAAGGTCGCCGCTCCGGCATCACGACCTTGGTTTCCAGCCACC
TCATTCTCTTG