Description :
From Genome Similarity Track
Location :
Scaffold_348:14171- 16360
Sequence
2189 bases(100 bases per row)
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNATCACTCTCGTAATTTCATTCT
GTTCACCTTGCTTTCGAAATCACTTGGTCAAGGTCGCCGTTCATAACTCCACACACGATAAAATTCAATCAAAGTCACTTCCATCTCCAGACTTGTTCAC
TTTCGACGATCTGAATCCAAAATGCGTTCATTGCCAGACTGCAGTATTGAAGGTCCGGGTGTTGGCATCTTGGGCAATTTCTTGCATCCAAGGTACTAGT
TCCTTGGATGATCATCTCCAGCTTGCATAGCCTGGAAACGGGCTCTTGCGCGCGCACCTTGGTTGAACTCGTATAGTAGAGCACCACAGTTAAGCCTCGA
CACAGGTAACCATTCCGTTTCATCGTAGCCCTTCCATTTCACAAGGTATTCGCGAGAGCGCCTTGATGTCCGAGTTCTCTTAGTCCAGCGTAAATCTAGA
ATTCGCTCGACTTCATACTCGTCATTTTCTACGTCAGGTTCCCAGCTATCTTCTGGTAACAAGGCTGCGTCGAAAACGTCATCTTCCTCCACGTCTATTT
CCACAGCGGGTCGCTTTGGGAACAATGCTCTAGGCTTTAGTCGACTCACATGCACCCAGGGATTAACACGATATCCTGAGTTCTCAATCCTGAGTTTCAC
TCTGAAGTCGTCGTGCATTTCCTGGATACGGAATGGACCATGCCACATGTGAGCTAGTTTTCGGCTGAGTCCGGGCTGCACCTTCGGTATATATAACCAG
ACAGCATCGCCCACAGCGAAGCCAGCTCTCAAACGTTCGGACAGTTCTTTCCATTTCCTGGTCTGCTCAGCAGAACGCATGCGTTTAGCCTTCTTTTGCA
GGTCTTTGGCACAAACCTGAGCGTAGCTGTAATCACGCTGCAACTTCCGACGCCAGTCATACGCAGTGCGTTCCTGGACGCTCGACGGCTTGGGTCCAAG
CATAGCAGACACCGTACCGTGTGCGTCCCAGCCGTGCACCAGGAAGAAGGGGGTATCCAGTCTCGTTGCATCAAATGACGAATTGAGAG