Description :
From Genome Similarity Track
Location :
Scaffold_90:1417- 4035
Transcript NameFunction/comments
Physo_140796reverse transcriptase

Sequence
2618 bases(100 bases per row)
CCGCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNCGCCAGCACTTCTTTCTCCACCACGTTGTAGTTCAATTCATTCGACTTCAGCGTTCGACTGGCGAAGGTAACGGGATGATAGATCTGGTCGT
GTTCCTGCATCAATGCGGCCGAGATCGCCCAGTCACTCACATACACAATCACGACCGGAGTCCGATCGCGATCGAAGTGCCGCAGGATCGATGTCGTCGC
GATCTTCATCTCCAGTGTCGAAAAGGCACGATGAGTACGGATCCAGCGTTCATCGGCAACACCGACTTCAGGAACTGGTGGAGTCCGATCGGGGTTCACT
GGGTCCGTATCCACTAAGTTCGGCACTTGACGATCCAGGATCTGGCGCAGATCGGGGCGCTTCTTCAGCTCGGCGAAGTCCACCTCGCGCAGTTCGTACA
GGATCGCCGCGTAGATCGCGTAATCTTCCAAGAAACGGCTGTAGTAGTTGAGACTGCCCAGGAATGACTGCATCGATCGGAGCGATCCGGGGAACGGCAG
ATCAGTCAGAGCAGTGAGATCCTTCGGATTGGCCTCCAGCCCATCGTTCGACACACGATGCCCCAGATAGTCCACCTTACGCATCCCCCAAGAGCTCTTC
TCCACACTGATCGAGAGGTTCCACTTATCACAAGCGTCCAGCAGGTGATCCACGCGATCACACAGCTCGTCCCATGATCCGGCCGTCACAAGAATGTCAT
CAATGTACGATCTGCGACCTAGCACTGATGGACGCCCCGGATCTTCTGATTCTCCTGACTCGATCAAGTCCGTAGTGACTTCACAGTCCGACGATCGCGG
GATCCTGGTGAACCCATACAACGCGTCGTCCAGAAGTCGCTGATAGATCTGAGGAGCGTTCTTCAGGCCGAACGGCATCCGGTTCCACTCGAACAGACCC
ATGTGGGTGATAAAGACCGAGATGCACGAGCTCGATCGGTCATTGTCACCACCCAGAATCCACTAGCCATGTCCAAAGAGCAATATCAGAGTACCTTGCC
CAGATCTTCTAGCAGATCGTTGATCAAGGGTATCGGATATACCATCAGCCTGGTTAGACTGTTGACGAGCCGATAGTCGATACAGAGTCGGATATCCACG
CCGTTTTTTCTTGATGATCACGACGATCGGCGAGGCCCGCGGTGATCGAGATTTCCGAATCGTCTTGGCTGACAGTAATCCCTTGATCAGCTCGGACACC
TTCTCCACGAACTGAGGGACAACTTTCCGGACGCGTTGAGCGATCGGCTTCGCGTTGCCCACGTCGATGTCGCAGGTGACGCCTCGGGTTGCTGGGGAAA
GTGCATTGCCCTTGCCGATCAGCAAGTGATTCCTGTGCCAGATCTTCTTTCGCAGCCGATCGATCTCCTCCGGGGTGTTGAACTCCCCCACCTTGATATC
ATCGATCTTCACCTCATCCGTCGTCGAGATCACAATTTCAGGAAGCACAGCTAATTCACTTTCGACATCTTCTGCTGACAGATTCCCGCCCTCGTGGTAA
TGGACCTGGTCGTCAGCG