Description :
From Genome Similarity Track
Location :
Scaffold_737:1417- 3171
Transcript NameFunction/comments
g16039.t1hypothetical protein

Sequence
1754 bases(100 bases per row)
CACGAGATTGATCTTGTGGCGGGGAACGTAATACTGGCGTCACGCGACAGTGGCTCACTCGGTGAGCAAGTCAGCAATCGTACGATCTTCTTTGGAAAGT
CCGTCGCAATGCAGGACAAGTGGCGGCGAATGAAGTCGCCCTGCACAGCGCGCCTACTTCTTGTGTGAAGAACTTAACGGGCGGATGGCGCATGCGGTTC
ATGCGTACAACAAGTCTGTTAACGATGCGACGGGTAACGCGCAGACGCTCGATACCGCTCGAAAGATGTGATATCTGATTCGATGACTCGAGTACTATCT
TCAGTACTCTGGATCTGATAGACGGGTTCTATCAGATCCTCATGCGTGAGAGTGATATCCCTCTGACGGCGGTAAGCACTCCGAGCGGCATGCTCTGGGA
GTGGCTCGTGATGCCGCAGGGGCTGAAGAACGCCCCAGCGACGTTCAACAGGTGCGTCACGCACTTGTTGCGCTCCTTGCGCGACTTCGCACCGAGCTAT
TTCGATGACGTGTTCATTCACAGCCGGGCTGTGAATGGGAAATCGGATGTGGAGATGCATACAGAGCATCTCCGCAAGTTGCTTGAGCTCATGCGAAAGC
ACAAGCTCTACGCGAACCTGAAGAAGTGTATCTTCGGGTCGACCGAGATACCCGTACTTGGGTGTCTCGTGGGGAAGAACGGCGTACGCCCTGACCCAGG
AAAGGTCAGAGTGATCAATGAATGGCCTACGCCTTCAATGTAAAGGAACTGCAGCAGTTCCTTGGACTCGCCACGTACTTGTGCAAGTACGTGAAGCAAC
TACGCGGCGAGATTCGCCCGCTGTCGCAGCTCTTTAAAGAAAGAGGCTGGCATGGGAATGGACTGCTGATTTGTCAGCAGGCCTTTGAAGGCAGTCAACA
GGCTTGACTGAGGCGCGATCTTGGCGGGCCGACAAGATGCCTTCCATCGTGTTGTGCGATGCATCGATTTGGCGATCGGATGCGCACTGATGCATATCGA
TCGACGAAGTCGTGATCCGTGTGGTTACTACCAAATCGCGTCAGCTTGAACGCAGCTGATGCGCAATTACCGCGGTACATAAAAGGAACTCCTTGGCCAT
GAAGTATGCACCTCGCAAGTTTCGAGTCGATCTACTTTGGGAGAGACCATTTCGTGGTCACACCGACCACGCATCGTTGCGTTACGCGGATCAAGTCGCC
GCAGCATATCACAAAGAAATGGCACGGTGGCTGTCATTCTTTGCTGAATACAACTTCCAGTTGAGTACAAACTGAAGGTTGAATTCTCGTGGCGACGCGC
TTCGCGCGGACCAGATTATGGCGTCAAGAGGCCGACGCAACGCAGTTGGCGTCGTCAGGACGACTACACCCTCGTCGTCCTTGCTGGACGAAGTGAAGGC
CGCATACGCACATGATGCGGATGCGAAGCAATTGGTAGAGTACTTCTCCACACCTTCTGACAAGTCTCGTCAGAAGCTGGCCAAACACCTTCGTGCCCGT
GTACACCGTTATCGTGTACACAATGGTCTGTTGCTTTACAGCGCAGTCAACGACAACGCAGATCGCATTGTCGTGCCGGATGATCATGAGCTGAAGCTCA
AGATCACGTATGAGTACCACGATGCCCCGACATCGGGACATCCTGGCCGTGAGAAGACATATTTGCTTCTCACGCGTGACTTCTACTGGAGTCACCAGTA
CAAGTGGGTACGCAAGTACGTTCGTGCTTGCGAGGTATGCCAGCGCGTGAAGCC