Description :
From Genome Similarity Track
Location :
Scaffold_3014:1417- 2424
Transcript NameFunction/comments
Phyta_totarag15006hypothetical protein

Sequence
1007 bases(100 bases per row)
AGAATCAAAGGCCCCGCACAGTGCAGCGACGTTCTGTGTTAAGAAACCACAGAGTGGCTGGCGCATTGTTCATGCTtacaacaagctgaacgatGCAACG
ATACCGGCACAGACGCCGATACCGCGAAATGTCACGATCATCGATTAGATGGACTTGAGCACAATTTATAGTGATCTGGATCTGAGAGACGTGTTCTATC
AGATCTTAATGCGTGAGAGCGACATCCCTTTTACGGCGGTAAGCACCCCAAGCGGTATGCTTTGAGAGTGGCTCGTCATGCCGCAGGGATTAAAAAACGC
CCCTGCGACGTTCAAAAGGTGCGGTACGCACTTGTTGAAGTAGGAGCGCGACTTCGCACCGagctacttcgacgacgtgttcgtTCACAGCCGGGCTGTG
GATGGGAAGACGGATATTGAACTGCTCGAGGTGCACCTCCGTAAGCGGTTTGAGCTGATGCGCAAGCACAAGCTCTATGTGAACCTGAAGAAGTGTATAT
TCGGGGCGAGCGAGATACTCGTGCTTGGGTATCTCGTCGGGAAGTACGGCGTACGCCCTGACCCAGAGAAGATCAGAGTGATCAATGAATGACCGAAGCC
ATCCAACACCAAGGAACTGCCTCAGTTCCTTGGACATGCCACGTACATGTGCAAGTCATGGAGAACTACGCGGGCAAGATTCGCCCGCTATCACATCTTC
TAAAGAAGGAAACGCTATGGAACTGGGTCATTGATTGCCAGATAGCATCCGACGCAGTCAAGCGGGGCTTGACTGAGGCACCCATCTTGGCGATGGCCGA
CCCAGATCGTCCATTCCTCGTCGTGTGTGACGCGTCCGACTTTGCAATCGGATGcgcgttgatgcagctcgatcaCGAAGGTCGTGATCGTGTGGTCTTT
TACCAGTCGCGTCAGCTGAGCGCAACTATCCGGTACATGACAAGGAGCTCCTTGCCATGAAGTATTCACTCACAAAGGTTCGAGTGTATCTACTTGGAAA
AGACCAT