Description :
From Genome Similarity Track
Location :
Scaffold_33:141695- 145655
Transcript NameFunction/comments
Phyke_g1948hypothetical protein PHYSODRAFT_509599
Phyke_g1949hypothetical protein PHYSODRAFT_504986

Sequence
3960 bases(100 bases per row)
GTCGACCAAGCCCCACAATTTCAGGAGGCCTACCACGCTCAGGCTCTCACCGTGTTGGCGCACTATCTGGATGACTTTAACAAGCCACGACTGCAAGCTC
ATTCGGCTACTGCTCTTCGCCAATTTATTGACATGTGCCCGCCCAACCTGCTTACGCCGTACCTGGacaagctgcttcaccagctatttgcattgctgca
gcatggcCAATCTTTGGCTCCTAGCGACAGTCAGACGCCGTCCCAAGAATTCACTGCCACTCGCGTTGTTCAGGAGCAGGCTATCACAGCTATTTCGTCT
GTGGCGACGGTCGCAGGCACGTCTTTCAGCAACTACTACTCTGCCGTCATGCCTCCTCTGCAGCAAATTCTCTTGAACTGCCTGAACGAAAGTGTgcgcg
cagcagcagcatcaccgGCGGTACTGAAGCCACAGACGAATGCACCTAGCTCATTTACACTTGGCGGCATCACGCTAGAGTGTCTGAGTCTGATCGGTCA
AGCTGTGGGCAAGGAAGTGTTTTCGCGTGATGCCCCTGCAATTCTTAAGGTGATGGCTGAGATGCAAGCTACGCCTTCCATCGTTGGCAATGAGTTGATC
CGCACGTATTTGTTGCAAGCGTGGGCTCGGTGCTGTACTTGTCTTGGACGCGATTTTGCACCATATTTGCCACTTGTAATGCCCACCCTTCTAGAGGCGG
CCACGCAGCAGGCAGAATTCGAAGTGGACCCCACTACCTTGtccagcgacgatgatgacgacgaaagcgGCTCCACGGACAGCGAAGATATTCAGCTTGC
TCAGGTTAATGACAAGTGCTTGAGTATCCGAACATCCAttctggaggagaaggccaCAGCCTGCCAACTGCTGGCTGGTATGGTGACGGACCTTGACGAC
GCTTTCTTTCCGTACGCTGAGCAAGTTACGCAAGTGCTAGCGCCACTGCTCACGGACTCTGTGCACTCGGACATCCGTGCCTCAGCCATTCGTGCCATGC
CAGCCCTGGTGAAGTGTGTTGCCAGTTCTACTGCGGTGCCTGGATCGAAAGAGCATGGTGAAGCCGCCATTAAGCAGATGGTGGACTTTGCTCTAGGCCG
CTTAGTTCTTGCACTGACTTCTGAGCCCGAAGTCGATTTGGTCGTGAGCATTATGCAAAGCATGACGAAATGCCTTGGCGATGCCCACGAACTGCATCCT
ACGCTAGTGCTTAACGAAGCACAGTTACGCGAGCTGGTGCAAGGCCTGTTAGTGGTTCTGGGCGATAGTTTCCAGCGGCGTGCGATGCGAAGACGTGCAG
CGGACAGTGACGAAATGGATGGTGGTGAGGCCGATCTAGAgttcgatgacgacgatgacactTCTCAGTCTGGTGAAAGTCAGGTAGCCGAGCAAGAAGT
GCAGTTCGTCTTGGCCGAGTGCATAGGATCTCTGGCTAAAGTCCACGGTGCGGCATTCTTCCCTGTTTTTATGAATATTTTGTGGGAGAAGATCGCGGCA
CTTGTGGCACCCGGTTGTCTTGTGGAAGACCGGCGCCTCGCACTATTTGTGCTGGACGATGTTCTCGAGCACTGTGGTGCACCAGCCATGCGCCGTCTGG
ACATCTTCTTGCCTGTAATGGAAAACGCTTTGAGTGAAGTTGGTGAGCCGGGGCTTGTGCAAGCAGCGGCATTTGGTGTTGGTGTGTGCGCTTCGCAGGG
CGGAGATGCCTTCGCCCCTCATGCCGAACAGTGCTTACAGTTGTTGCGAAACGTTGTGGCTTATCCTCGTGCTCATAGCAGCCCCGAACAGCGCAATGCT
ACCGATAACGCTGTGTCGTCGCTTGGCAAATTCTGTGAGTTCCAGtcagctgcagtggatgcAGCAACGCTTTTCCCGCAGTGGTTGGAACTGTTACCTC
TTCGTGGAGATATGGAGGAGTCTCTTGCTGTTTCCCAGCGGTTGTGTCGTTATGTGGCTGACCGGCATCCACTTGTGCTAGGCGCACCAGACTATCGGCA
CCTCGGGAAGGTCGTGACAGTGCTGGCTGCGGTGGCTGAGGAGAAGTTCTTGCGCAAACTGAGTCGCGACGTTGGCGTGAAGGAAGCTACGGCGCTGCGT
CAGGAGCTGGCTTCCACTTTGGCTGGCCTCCGTGCCACGGTGCCTGAGCCTGTTATGGGTCAGGCCTGGGCTTCTCTTTCAGCCACCCAGCAGGCTGCGT
TGCATGCACTCTTCGCTTAAACATTTGCTATATAAGAAATAGTACTAGAGTCTTTCGAGCGGTAGGTTAGGAATCTAGATGCGCTAGATGAACGTAGAGA
TTATTAAGATTTGATTGCATGAATGCTTCAGTTGCTCTTCAGTCGAACATACATATAAGTGCCTACTGCACCTGATGAAGGCATCAATTTCGAATTGCAA
CACATACAGTGCACAGCGAATAGCATCTTACGCCAATGATCAAAAAGTACTCTTACATTTATATCCCATGGAAGTTCCATGATGGAACACTATTTTTCTG
GGAAAGCAGCCTAAATCACATTATTTATATAGTAAAAAACAAAGGGTTTGTACAAGCCATTTTAAGCTTGACATTTGTAAGGGATGCGATATTTATTTGG
AATACGGTGTGTACAGGCAGTACTCGGTCAGACTAATTTTGAATTCCAAATTCGTCTTAATATGCAGTTTTGTAAGGTCGGCCCAAACAAAATCTTACAA
GTCCGAATTGCAAAGTGACAACCAAAATAAAGCACACCCTCGCCTCGGTATATATTACAACACAACGCAACAGGTTAGTGCTACGCCAGCCTCATGTAGG
AGCGGGACTGCGAGAAAGTGATAGTAACGGGTATCTGGCAGCTGAAGTCAGTGGCGCCGCTGGGGCAATAGATCGGGGATTCACATTGGAATTATGCATG
ACTATTTTCTTCATTAATGACACTGAAGTCATAAAGTGCCCAACAACCGAATCGTATCTGCCATCGCCTTTTATTATTATTAAATATTAAAGAAAAAAGA
CACATGTAGGCCTTTAATCATGACGCCACTTCCCTCGAAATGGTACAATTTTACCTGCGTGCTAGTCGCTAGGAGAACTATTTTCTCTAGAAAGCTCATT
GTGTCTCGTCATTATCATATGTAGCACGTCGGATGCCGTTGCGTCTACCATAACGTCTGTATTTTCGCGGATGGTCTACGAAAGAGCGCAGACTAGTTTT
GAATGAGGCGAATTCTCAAGTACATTAATTAGTCTGACTAATTCTGAACACAGACTACTTACTGTAATCACTGTAGTATATTTTACTTCCCAAAGTTATG
ATTTTGGCCAAACACATCAACTTCTTTCTTTTCGAAGTCGAACAGTTTCGAAAactctcttcatcgccgacgtcgctctcgtcgtcatccacATCGAGCG
TATTGTGAAACTTTTGCCATTTGCATTGTTCGGAACATCATCAACCGATTTACTTAGGTCCACAGTCGGGATGGTTGGGTCTTGGACGGTGTTTGTAGTT
CGACGATGTAGCCATTTAGTATAGTGGTAACACATTCACGCAACATTCGTATTGTCATTCTTACACTTCGAACAAAACCATGGCAACGAACCAACGAAAG
GATGAAGGCGCAATGCCAGGAATTCAAGAACTGAACAGCACAAACGAGGCCTCTCGGTTCGGCGAGGCTCTTTCTGGATACTTCCAAGTGGCTAATACCG
CTCGGAAGCGCGCTGGTCGTCGTAGCCGACACGGAATGCACCTACAAGTTGAGGAGAACTGTGCAATGTCGTCCGAATGTTTCTTGAAACAACTAAAGAG
AATCTTACGGGATGCATCGCCTTCAAGCCAATCACAATACGTACAAAGACTTTTTGCGATGATTTTCCACCAATTAAACCACGGTAAAGTGTCgccgatc
atcttcaacCGGGTAAAAcaaatctgtgacgtgtgatGAAAACATTAAAATATTGATACC