Description :
From Genome Similarity Track
Location :
Scaffold_48:141689- 147352
Sequence
5663 bases(100 bases per row)
TGCTGCAGCTTCCGAAGTTCGCGCCATTATGTAGTATTGTGGTGTTGACCGGCGAGACCATGCCGCTGGTTTCCCGCGATAACATGTAAGCCGCTATATG
TTTGTGGGTGCTTTTGGAGATGCTGTTTCAAGCGTCACCTTTAGTTTTGAAGCTATAGGTGCTCAAGGTTCCGATTTGAGCGTGTAGAACACTAGGTTGC
ATATGTGTCTATTCCAGTATGGCCGGCGATGGTGTAACTACAACGCAGTGAACTGGTGCATAAATCTTATGCTTTGTATTTAAATGTGGCATTTTGTATA
CTAGAATCTGCCGCGCAAACTTGGCGCCCAAATTATGGAGCTACGGCAAAAAAATATTGTTTCTTTGTTTGTATATAAAAAAACAAGTCGTGATGGAATA
TATGGTATTCATGTACCCTTATACTCTCCACGAATAGGCGACGCGTATCAGCCGTCCATCCGTCCCCGCCCTCATTTGTAAATCAAGCAGAAAATGTCGG
AAGTGCCGCGTGGCCAGAAGCGCAGGCATGAAGGCACGGATATGGCAAGGAAGCGGCGACGCGTGCGTACCGGTAGCGAGGAGGCACCTGATGAGACAGC
GAGCAGCCTCGGGGGCGTTGCTGTGTTCAACAGCGAGTGACGAGTGTTGGCAAAGGCCGGGTTGACGTCCAAGCAGCCTTCTACTAAGTCTTTGGACACA
CGCTACAAATACATTCGGCCTGGAAGGCGACACGACGGCGAAGAGGGGACTGACTACCTACTTGTAGAAATGGCCGTCCTAAGGTACATTGCGAAGACGC
GCCTCCTCGGAGTCGGTGCTGAAGTAGGTATTGAAGGCGGAGGCCGAACTGAGGGGTGCTGAAGACGCCGTGGACTAATTGTGTTTTGTTTTGCTTTTGA
TATAGGCACCAGCGCTGCCAACGACGATGAAAGAGGCGAGTGCGGCGATCTTGGAGCAGGTGCAGCTCCCGGTGAGGCGGCAGCGGTCGGCCGTGCCGCC
GATATGGGTGCTGGTGTTCCGGCAGCCGGCGCCGGTGCCGAGCGTGGAGCGAGAGGAGGGCGTGGAGCTCGGAGAGGGCGTGGCACTTCACGAGCAGCGA
GCGGCGGAAGCGCTGAAGGTGTGGGTTAGGCAGTGGCGGTGGTGCGGTTCTAGTTACTAACTGTGTGCATTGTTGTTGGTGCAAGGTGGAACGTTTGGCG
ATGCTGCGATGGCTTGATTGTCTGTCGTGCTGGGTGCTTATGGGTGGCTGACGGTTCTAACCAGCCGGCCGGCCGGTGTCCGCGCGTGGAGCGAGAGGAG
GGCGTGGAGCTCGGAGAGGGCGTGGCACCTCACGAGCAGCGAGCGGCGGAAGCGCTGATGGTGTGGGTTAGGCAGTGACGGTGGTGCGGTTCTAGTTACT
AACTGTGTGCATTGTTGTTGGGGCAGGTGGAGCTTTTGGCGATGATGGGCGATGGTCTGATGTCGGCCGTCGCCCGGTGCCGCGCGTGGAGCGGGAGGAG
GGCGTGGAGCTCGGAGAGGGCGTGGCACTTCACGAGAAGTGAGCGGCGGAAGCGCTGAAGGTGTGGGTTGGGCTGTGACGGTGGTGCGGTTCTAGTTACT
AACTGTGTGCATTGTTGTTGGTGCAAGGTGGAGCGTTTGGCGATGATGCGATGGCTGATGTCTGCCGTGCTGGTGCTATGGGTGCTGACGTTCTAGCAGC
CGGCGCCGGTGCCGCGCGTGGAGCGAGAGGAGGGCGTGGAGCTCGGAGAGGGCGTGGCACCTCACGAGCAGCGAGCGGCGGAAGCGCTGAAGGTGTAGGT
TAGGCTGTGACGGTGGTGCGGTTCTAGTTACTAACTGTGTGCATTGTTGTTGGTGCAAGGTGGAACGTTTGGCGATGCTGCGATGGCTGATGTCTGCCGT
GCTGGTGCTATGGGTGCTGACGTTCTAGCAGCCGACGCCGGTGCCGCGCGTGGAGCGAGAGGGGGCGTGGATCTCGGAGAGGGCGTGGCACCTCACGAGC
AGCGAGCGGCGGAAGCGCTGAAGGTGTGGGTTAGGCAGTGACGGTGGTGCGGTTCTAGTTACTAACTGTGTGCATTGTTGTTGGTGCAGGTGGAACTTTT
GGCGATGATGCGATGGCTGATGTCGGCCGTGCCGGTGCCGCGCGTGGAGCGGGAGGAGGGCCTGGAGCTCGGGGAGGGCGTGGAGCCCGCGGCGGTCGTG
GAACCCGAGGAGGGGGTGGAACTCGAGGATGGCGCGGAGCTAAAGGAGGGCGTGGAGGCCCTCGAGCCACGAACGCTGCCAGCACTGAAGGTGGCGGCAG
TGCAGTTGGTGTTGTCGACTTAGCCGTCAGAGCCGGGCATGTAACGCTAGCAGTGCGAGAAGGACTTGGTGCACAAGGAGGGCATGGGGGCTCGCTAACG
GGGTCTCTTAAAGTATCCTGTCCGTGATGCGTCCGTAGAAGGTAGATAAGGTCTTAGCCCCGACGCTCCAGAGGCATATGTTGGCCGACGCCCCTGGTAG
ATTGATGAAAGTTGTCATATCATTGATTTGAGAAGCAGGCAAGCGCCGAGACGCTATCCCCCCCATGTAGCCTCGCTAAGCGGGTCCCGTACGTATAGCG
TCCGTAATGCGTCCGTAGAAGGTAGATAACGGCCCTTAACCCCGACGCTCCAGAGTCATATGTTGGCCGACGCCCCTGGTAGATTGATGAAAGTTGTCAT
ATCGTTGATTTGAGAAGCAGGCAAACGCCGAGACGCTATCCTCCCCATGTAGCCTCGCTAACGGGTCCGTACGCATAGTGTCCGTGATGCGTCCGTAGAA
GGTAGATAAGGCCTTAACCCCGACGCTCCAGAGTCATATGTTGGCCGACGCCCCTGGTAGATTGATGAAAGTTGTCATATCGTTGATTTGAGAAGCAGGC
AAGCCCCGAGACGCTATCACCCCCCCATGTAGCCTGGCTAACGGGTTCGTACGCATAGTGTCCGTGATGCGTCCGTAGAAGGTAGATAAGGCCTTAACCC
CGACGCTCCAGAGTCATATGTTGGCCGACGCCCCTGGTAGATTGATGAAAGTTGTCATATCGTTGATTTGAGAAGCAGGACAAGCCCCGAGACGCTATCC
TCCCCATGTAGCCTGGCTAACGGGTCCGTACGCATAGTGTCCGTGATGCGTCCGTAGAAGGTAGATACGGCCTTAACCCCGACGCTCCAGAGTCATATGT
TGGCCGACGCCCCTGGTAGATTGATGAAAGTTGTCATATCGTTGATTTGAGAAGCAGGCAAGCCCCGAGACGCTATCACCCCTCATGTAGCTCTGTATAA
CGGGCTCGTACGCATAGTGTCCGTTGATGCGTGCCGTAGAAAGTATATACGGTCTTAGCCCCGACGCTCGAGAGTCATATGTTGGGCCGACGCCCTTGGA
AGATTGAAGAAAGTTGTTCGTATCGTTGATTTAGAAAAGCAGGCAAGCCGCGGAGACGCTTATTCTTCCCCATGTAGTCTCGCTAACGGGTTCCGTACGC
ATTGGTGTTTCGTGATGCTTCCGAAAGAAGGTAGATAAGGCCATAACCCCCGACGCCTCCAGAGTCATATGGGTGGGCCGACGCCCNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCCAGCAGCTTATCT
TCAGTGTCTGTAAAGGTAGTGCGCAATTAGTCTTGAGTACACTATAGAAAAATGGGAGGTCGGATAGGTGCATTCGTCTTGCCTTTTGTATGTTCTGGTG
ACTGGCTGTCAGGCGATTGACCGCTAGATCCATGGTACGACCGCGTAGAAAGGGCCGATTACGATCGTTGGAGCAATAAAATACTGTGCGATGACCAGAC
GATCCAAAATTACCCCCAACCTCTTTCTATTCACAGCTGCGATTGGTAGTTATAAACACGGTTGGCAGAGTTGGAGGAAAAGCTAAAAGGGCGCAAAATT
CGCCCTTTTACAAGCCCTTTTTCCACCTTGTTTTGGTAATGGTGTTAAAGGGCGAAAAATGCGCCCTCGCACCGCGAAAGGGTTAATTGTCTTTTGTCTC
TACCCCAACTTTTTCACTCGGATAATTTACTTTACATTTCGTCTATGCACTACTAATACAAACATCTATACAATTGTAGTTTCACTCAATTCGATGATTT
TACCCAATTTCATCATGTGTATCGACTTGAATACTAGCGGTAGCTCGAATATGGGTTGTGCATCACATGGCCCCATACCCAACACAAGTTTTCCAAAATG
TAGAGCAATGTGTAGCACAAAAAAGTACATTCGCAGCGCCAAACATGCTTCTGCTCGCTCGTTTTACCGGCGATGAAGTCGCCGCTTAGCAGTGGGATGA
TGATCTTTCTAGGGCACACTGGTGCAACCTCTCGCTTGTTGTCGACGAATCAAACTCCTCAGCGTAGGCCACAGAACTTGAACTTCTAGAAGCATGCTGA
AACCACACAGGGCTAGCCTCGGACAAATCTATGGTCAACAATTTGAGCTGCTCGCATAGTATAAACTCGAACCGCAACTGTTGCATAGTTTTTTTGTAGG
TACTACGCATTTACTGAAGCGAGCCTTCTTCTCATCCGAAAGAGCTGTAAGACACTGAAGACGCAGCAACTCGACGTCAGATTCTGAGAGGGAAATGCAC
GAGTTTGCATTGACAATAAATGTTACACTGTCGACCCTGATCGTCACGAGAGTAGCGAGATTGCTGCTGAATAGTATCCTAAACGCGAGAAGCCTTTGCA
GTTGTTGCAAGTTCGGTTTGACAGCTTAGGTTGGCAGAAGATGCTCTTGGTGAAGCTAATGCTGATCCGACACTGTGCAAATCTCGCCAGCAGTCGGTCC
AGCGTCGCCAGACAGCTGTCGAAATCCTCGGTACCGAAGCAAATATAATCCACAAACGATCGTCTACCAAACATTGGTACCAGCGATGATTCGTCTGGTT
CCCCGTTCGTAAACATGTCAGCGACGGGGCTGTTGACGAGTTGTAGTACAGGATTGGCCTCCACCAAAGCATCGCGGTCTGCCGCGAACTTTGTTTGAAA
CGAACCCTCGATGCTTGGCCCACTACGTTCCTTGGCCTGTTCTTCAACTAAACGCATCTTCTCCGAGTATTCAAAACCAACCTTTAGGTTGTACGAACCC
CCAGAGCGCGTTGTCAATCATACGTTGGTAGATCATCGCCGCGTTCTTTAACCCGAAGGGCATGCGTAACCACTCGAAATGTCCGAGTGCGCTGACACTT
TACGTGCTCGCAAGGTCATCATGACCGCCCAGAAACCACTTGCAGCATCCAGCGAGCAGAACCATAGGTAACACTCGAGATCGGTCAGCAGATCGTCGAC
TAGCGGCATTGCATGCTCCATGATTGCGGTGATAGCATTCACCATCTTGTAATCAATTCAGAGCCGGATGTCCAGCCCGTTCTTTTCATCCCAATCACGA
TTGGCGATGCCCATGGACTGTCTGAAAAGACGATCAGTCCTGCTCGCAACAAAGCGCGTAGCAGCTCGTACAGCTTAGCGAGAAATCGTAGCGGCACGCG
CCGGGCGCGCTGTTTGATTGGGGCATACCTCTGCGTGTCGATATCGCATACCGCGCCGTATGC