Description :
From Genome Similarity Track
Location :
Scaffold_173:14166- 16006
Transcript NameFunction/comments
Physo_144216predicted protein

Sequence
1840 bases(100 bases per row)
CTACCGTCACCAGATCCATCGCATGGAGTGCCTCGGTCACGAGGTGGTACCGTTCGAGGATATCCTTTGCCAGATGTCGGACTTGCTGCACCCGGAGAAG
GAGGGCGAGTTCTACCACAAGGACTTTATCCGCCCGGACAAGATCCGCGTGTCCGGCGTGTTCTTCAACGTGCTGTTCAACCTCAGCAAGTTCATCGAGT
TCGAGCAGCGCGACCCATTCCTTCTGCGTCAGCAACTGGCCGAGCCGGAGCTTACGTACGTACCCGCAAGGAAGGACATTGACACAATGGCTGACTATTT
GCTAACCGAAACTACTGTTGCTGCTGCTGAATACAGGGATTGGGACCGCTACGCTCGCGCCGAGTACGCTCGACTTGCCATGGAGGAAGAAAGCCGCGAC
GAGGATACGGCGATGGACATCGACACCATGGACGGCTGGTATGTGTCGGACGAGCAGGAAGAAGACGCGCCCGAGGGCAGCAGCTCCGGCGCCGACGGCG
CAGCGGGTGGAAGCGAAGGCCGAACCGTCGAAGCCCCCTTTTAACCTTTGCCCCCCCCCCCCTTTCAACGAGGTAGAGCCCCCTTTCATTTCCCCCCTTA
GAAGACGGCGGACGGCGCTCTGGGCCGTGCCGCAGGATGAAGACCCGACGCAGATGAAAGTAAGTAGAGCAGCATGCGTGAGTGAATCAAATGCATGTGA
GTCAATCAACAGTCGAAGGACAGTTGAGTGGTGCAGGCTTTATTGCTTCTTGTTGCTGGCCGCGGCCTCCTGCGCCTTGCGCAGCTGGTTGACGCGGTCG
TTGCACAGCTTGAGCTGCTTGACCTGCTGCTGGCACTTGGTCCAGTCGCGGTCGAAGTCGGCCAGGCAGTCCTCGAGCTTGTAGTAGTCCTCGTGGCAGC
GGTTGCGCTCGATGAGCTCGTCCACGTCCAGGTCCTCGCCGAAGTCGCTCTTGCTGCCGGCGTGCAGCCCCGCCACGGGCACGGGCGCCTTGGGGAACGC
GGCGCTCATGAGGCTCTGGGGCGGTCGGTCCAAGATGCGAAGTGGCGGAATTGACACGCACGGGGCTGGCGGTGGTGTGGGCCACATGATATTGCTGCAG
CTTGCAATATTGTTGATTGGGTGAACGGATGAAAACTTCTTCTTCTTCTCCATGTTCTCATGATGCAGAGCATGTTCGCAGTTCGAAGAACTGTTGGGGA
AGGTTTTTGGATGACATCGAACGACATTCACGCTACATACGTCACGTCACCCCGTGCGGATGACATCAAACAACATTCACACAACATCACACAGCACTCA
ATAGAATCCGGTCTGAATTGCACAGTGCAATTCAGACCGGATTCTATTAGCTGTAAGTGCAAGTTGCACTTACAGCTTTTGATAGATGCCTATTCGCCTC
GGAGCTTTTCCTTCTAGATTGATGCCAGAGGAGTGGAGCTCCAGCACAAACATTTTATTGTTCGAAAGAATGCAATTCTTGCTATTGCACAGATAACGTT
ATGTACATGTACGTTGTTCGTCGTAGTAATGGCGTCTGTGACAATTAGAAGCCTCGATGCTGACCTTGAGCACAACTGGTGTCATTACCACATCACTGCA
TCGTATTAAACTGCATGCGGCTCCACAGCACTCGACATAGTACTCACTCATTTCATTAATGTTAAAGCTATCGATTCAATCTGTTCAGTCCTGGGTCATA
ACTTTTACCCTCCTCTTTCAGACACAGATTTTCTTCTGCATGCATAGAGATTTATTGAAAATCTTTTGGTCACCTGAGTTTGCCATGACTTAAATTGTCG
GCAGGCTGATATTGTGTGAATTCCCACACTCATTGGAATG