Description :
From Genome Similarity Track
Location :
Scaffold_245:14164- 15275
Transcript NameFunction/comments
Phyag_g3903hypothetical protein PHYSODRAFT_313163

Sequence
1111 bases(100 bases per row)
GCCAAGATAGTAATTCGTGTCGCTGAGAAGCGAGGCAAATTCgtcaccaccttcatctGTCGGGCCTAATACCTCGCCATGTCCAGCTTTGGAGACATGG
CGAGCATCGGACTTGCGAGGTGCTAGAACGGCAGGGTCAACACGGAGCCAGAAATCGTCCGTGGCTGTGACCTCGTCATTGCGCGACGGGTTTCGGAAGT
CCACCTGAGCGACGTCAAGTCCAAGTTAGTTACCACCGCAAAGCATACGCACGTGCAAGTATTAGCTACGCACAATGGTGAAGATCATGTGCGGCCCAGC
GGAGCTATCCAGTGCAGGGCTGCTACGACCATCAGACCCAACAGCGAGAGGCAAGTCGGAGCTCGACGAGAGGAAGCAAATTTGGTCGCCAAAGTGGATC
GGCGTCTTGGTCGAAGTGTTGCCGTCCTGCAGACCAGCACTCCTATCGACGGGAAATTGTAGCAAACCTAGAGAGTTAATTCCTAGCGTTCAAGTGCACG
AAACACCAATACTCACGGGTGGACTTGTTCCTGCTTCGTCGCGTTTACTCCGTCGCGCTTGAATTCTAGGAAGGCCAGATGCGCGTTCTTGATCTCGCCA
TGCGCAGGAGCCAGCGGTGGTGCCAGCGACTTGGCGTTTGCGAACGCGCGTCCTCCCCGCAGCAGAGCCATAGCACGCAAAAGTTTATCTTGTAGCGACT
CCCGTGCTTCGGAGGCGTCCTCTTGGCTCTCCATTTCCTtcagcgcagcagcacagacCGTGGCCAGTTTCTTCAGGAGATCCGCCTTTggcacgagagc
agcacgtcggTTCTGCAGGTGCATGGTCTTCTCCCTGTAGATCTTGGTGGCCATGAAGTTCTGGTACTGCTCAAAGGACGTGGCGGCCTCGGGCACCTGC
gcgtcgtccttggccagACACGGCAGTGCATtgcgttggcgtcgttctCTGTGCTCGTCTATTGGCTCGACGTTGATCGGTTTGTTGGTAGCAATGTGGC
CGCGGCGTTTGGTTGCTATCGCTAGTGTCGGggctggaggcagcagcggcagggaggaggaggacttGTGCATCTGTGGCGGGGCTtgtagctgttgctg
ttgcagcacGT