Description :
From Genome Similarity Track
Location :
Scaffold_11:14163- 15483
Sequence
1320 bases(100 bases per row)
GTGGTGAACTACACGAGATGGGCAAGTGTCCGATGGAGGAATTCTACAACCAGACCCGTCAATGGTTCAACCCGGTGAAGCACGCTGGCATGTTGCCCGC
GATCGCCGAGAAGATGTTAAACTAGGACGCTCGCCGGGTTGGAATCCGGTACGAGCCGAGCGTTCTAGGTACTGCATCTATGCATTCGTGAACAAGAACA
CGGTAGATCGAGTAAGTGGACGGACTGATCTACGCGGTAATACATGTGATCTGCATGCGAAATTTGCCGCCAAGGTCTTAAGTCTACGTCGATCGGACGA
CTTCAGCTGTTCTGACGCCGAAGTGCCCTTGGATCTCCAGTCTGGAGAAACGCGGGGCTATTGGAAGCAACGCAGACCGGAGGAATGGTTCAAGCCAGCT
GATGGAGAAGTGACAACCGAGATCCCGGAGCATGATCTCGATCGAAGTCTGCCTCGCGTCAGCGAACACCGTAGTCCTGGCGATGTGGTGCTCGATCTCC
TCCCTGGGGAGTCTAGAGGGTACTGGAAACATCATTCGCCAGGTAAGTGGTTCCGTCAGGCCAAGATCACTGGCAAGATCAATAATGAGAAGTCGATCTT
ACTCTTAGACACCGGCGCCGAGGTGTCCATCGTGGACACCGCCTTTGCTCGTAAGGTGGGGTGGTATGTCGACATGAGTCAGAGCCAGGAATGTGTGGGG
ATTGGCGAAAGCGTGTACATGACGGAAGGAAGGACCAGGATCAAGGTTACGCTGGCGGGATCGCTGGTGTTTTTCTTCGATATCTGGGTTGGCGATCTAT
CAGGACAAGAGGCGATCCTGGATATGGACTTCATGGTTCCGGCGGGGATCCGCCTCGATCTTGCGGACGGCTCTATCTGTCTCCCCGACGAAGTCAAGAT
CCAGCTTAGCGGACGGCGTCAGCTGTACAATGACAATGTCCGACACGTGTGTGTGGATCAGGGAATGCAGATCGCGATCGGGGATTCGATCGAGCTTTCG
CTACGAATGAAGGTGACGGATCGAGAAAAGCTGTGGGTCACCCGTGGAGATCGCTGGGTGCCGACCGTGGTCCGAGGACTCGGCAGGATCCGAAATCTCC
AGGTTACCAACATCAGTGACAAAGACCTCGTCTTGCATCGGAATGAACGGATCGCGATGTGGCTGGCTGGAGATCGGATACCCCGGATCCCAGGATATGT
GTCGATCGGATCTCGTCGATACATGGAATGGCAGAATCTAGCCTTTCAAGCCATGACAGATGACCGGCCGACGAACCAGGAGGCACCAACGGGACCTCCA
GTACCTGCCGTCGAGCGACC