Description :
From Genome Similarity Track
Location :
Scaffold_153:14160- 15328
Transcript NameFunction/comments
Albla_Nc14085320conserved hypothetical protein
Albla_Nc14085330conserved hypothetical protein

Sequence
1168 bases(100 bases per row)
ATGTCGAAATGGAGCAGGACTCGCCAGCCGCCTGCTGGCTACGAGTATATAGAGCCCGTAATGGACGCACTAGCGAGTGAACTGCGTGAGAAAATGAACG
AACCGCATGAAGGTAAACGTCAATGTGAATCGTTGTGGCCCATTCATCAGATAAGCTGGCAACGAAGTCGTTATGTCTACGATATGTTTTACATCTACAA
AAGAATCTCGCGTGAGGTGTACGATTACTGCATCAAAATGAAGCTAGTGGATGCAAATTTGATAGCAAAATGGAAAAAGCCCGGATACGAACGTCTCTGC
AGCACGTACGCAATCAATTCGAAGAATTACAATTACGGAACAGTAAACATTTGCCGTGTTCCTCGCCACCAATTATCGGAGGATCAGGTTATTCAAGAGA
AGCACAGTGGATGCCGAGGCTGTGCATCTGGTCCCGGAGGATACTCTAATATATTCGGAAACAAGTATGGCCAGTACCTTGCGAGAATTCAGATTGCGAG
AGAAGTGCAAGCGGCCAATGAGAGCGAAAAAAAAGATGTGTGGGCGACTCCAGAAGAAGACGTTGGAGAGGAGAAAGTCACCAAGAGGAAATGGAGTCAA
CGAGGTCTGAACGATAGCGAGGATACAAAGACACGCAAACGTGCTTGTGCTAATGACGATCAAACGATCGAAATGCAGAAGGAAGAGCGTGACGAGTCTG
ACATAGACGAAATAGGAAATCCAGTTGAAAGCTCGGCAGATAAAACCACGTCCAAAACTGATGAGGAGCAGTCATAAGAGGAAAAAAGCGATTAACAGAA
CTAAAATTCAAGATAAAGCAATTTTTCAAAAGTTTTGACTACCATGTAAAAGGAATGAGCTTCCATTTTGGCAGATGTGCTTGTTTACTAAAGTGTTTGC
GATACCATTCAGACGAAAGTCGTGCAGAAACAGACTGATTTGCACACACCCAGAGGAACACAAGCGACAGCGTATGATTCCTAAATGCTAGTATGCATGA
AAATGCAAAGTAAATGAGAATCTCTGCAGTGTACAGCGGACACTGCACGTATGTAAACCAATCGCCATGCGGTACTCCATACTGATTGTTCTCACCTTTG
ATTCGTGCCAAAATGGAGTTACATCGCCATTGATGGTAGCTTGCTTTCAAGAATAATAAAACTCCCGC