Description :
From Genome Similarity Track
Location :
Scaffold_101:1416- 2472
Transcript NameFunction/comments
g14964.t1hypothetical protein

Sequence
1056 bases(100 bases per row)
GAATCTCCATCTCGACGTAACCCTCGATATGGCCACATACAGCTGACCGTGGGAAAAGCAAGGAGTCGCCAAGTACAGTCCCAGGTACTGCACCGTTTGT
CCCTGCGCCTTGTTGATCGTCATGGCAAAGGCAGTCTGGATAGGAAACTGCCTGCGTCTCAGTCGAAATGGGAAATCGCGGATGTCGCCATCGCTGATGA
ACACGATGCGCGGGATCAACACATGCTGGCCTTGCCTGTCGCCGGCCATGATGGTGGCGTGGATGACATGGTCTTTGAGTTCGACGATTCGCAGGCGTGT
TCCGTTGCACAACCCCAGGTCGGGATTTAAGTTCCGCATCATGATGATCGGCATCCCCTTCTTGAGTTTCAGCTTGTGGGGTGGGATGCCACTGATGTTC
AGGGAGTTGAGCACCTGCTCGAATAAGTTCCCGTCCTCGTCATCCTCCACTGAGTCCGTGGACACATATTCTCGAGCTGGCCCAGTCATGCGATCCGCTA
CGGCTTCGTTGATACGATGGACTATCGCGTTCGTGGTGGGGAGGATGGTGCGACTCGCAAAGTACTCGTCCGTTGCGACTTCCGAATTGTTGATGTCGGC
GTACATCTCGTCGATCGTGCGCCGCATACCTCGCGGAATAGCTCCCGGACGGATCTCCTCGTCCTCATCTGGATCACCGGCGGGTTGTCGATGAGCATGT
CACGTGGAATCTTAATGTAGTCATTTCCCAGATCATTGTGTACCTCGTGTCTCCCCTCTCCAACCTTCAGCAGGTACTCGGAAAACGCAGCCATTTCTGC
AGCACTATCAGAGGTGGCAGCCGTGCGAACACGCATGTTCTCTGTCAGACGCACCTTCTGGAAAAGTGGCCACAGTTCGGATGACTTCAGGCATGCGTCG
ATTGTCTCTGTCGCCGAGCCGCCCTTCACCACCGGGAGAATTTGCCTGGAATCTCTCTGAAACTCGACCACGTATGGGAATGAAAAGAAACGTTGTTGAA
AGGCGGTTTATTTTGTCCAATCAGCAGCGATTTCATTCGGCTAGTTCCGATGTGGT