Description :
From Genome Similarity Track
Location :
Scaffold_12:141598- 144070
Sequence
2472 bases(100 bases per row)
ATACCCTATACCGAATTTGTTTTGTAGAGGGATACACCCACCTATGGGATACAGGATAGTATTAGCCAATCACAGTTGTGTCTTCAGATTGACAGGGCTT
GACTTGTTGAGGGATACACCAGTTTCAAGCCAGTATTTTTTGCACTCTCGGCCGCTCAGCGCGCGATCATTTCTGCAACGGCGAGGGCGCCACCAAGTCA
CCCTTGCCTGTCTGGAGGTCAAGGCAGGTGGAAAACGACGCGGGCCCTACCATTTTACACTGCTGCAATGAAGATGGCTATTGTCGAGCACCTGAGACTA
CACTGCAATGTTTGTTTCACTGTAGATACGTTCTTTCCGGGTCTACCTACAGAAAAGTATCAAGGGAGAAGAGTAGTGGTGTTAAGATGGGCTCGTCGTT
TAGCTCTATAGCTGCTGGGGGTGCTTCTGTCGGCGGCAGGAACAAACGCAAAGCTTGCTCTACTGAGCTTCGATCTCAAGTTGGGGTGGTGGCGGCGAAC
AAGCTAATAAGTTGGGCTGTGTCGGCAGCCGCATTGGTGAGATTCGGCCTTGAGAGACTTGAGGTAGGGTGCTCAGTTTAGTAATTTTGATAAATACATC
TGGGCGTCCGGTGCCGATTCGTTTTTTTGAGCAAAATCGGGCGTCTGGTATTTTAGCTCCGGTAGGGTGTATCCCTCTACAAAACAAATTCGGTATCGAG
AGCAGGCGGCCTCCAGTCGGAGGCACTCTTACGCTCCCTGGGGCTTTGCCTCTCACCCAATACTTGGCTCCAGCAGGGGCCCTCCCTTTAGGACATCTTC
ATCCGGGATCATCCAACCTTGTACACAGTGTATGCGCGAGTCCGACCTGGACTTGCTTCCCCCATACGCCATGCCATGCCCTCTCCTAGAGCAAGTTTCT
CCACCAACCAATCACTGTTAGGGCTCGAAAGGAATCCGGATCTCATTACATACAACAACGCTCATCGAGCTAGTGCACACTCAAGGGCGCCGAGTCCCAA
CTGTTATCTTCACCACTGGGACGTTGAAGTTATGCGTTCTGGCTTGGTCAACTTGCTACCATCAATGTAGCCACCACATCACCTGTAACCCGTATACCGA
CGCCGTCAAAAGTGGCCTATCATCGACAAGGGTCCCGACGTTAACGAGGCCGCTTCCTCTGACTTCGGCTTGTGGTGCCGCGGTCAAATCCTACGCCATC
ATCGGGGCAAACCCAAACACCTAAACAGCAGGCGATCATGACGGATCCAAACGCAGCAGAAAGTGGTGTGAACAGGTGGACCCATTGTTTGTAGCCCGCG
TACGCGACAAAGCGATGTCCTGTCGAAACAAAGCTCGAGAGGCTTAAACACGCAAGTTGAAAGATTAGAAGGAACCTATCTTCAATAACGCGGGCCTTCT
GTACCAAGGACATCGCTTCAAACGTATTGGCCATGACGCTGAGCACATCGACCGTCTGGTCACGACTGACCAAGTTGACCGGTCAAGATCTGTTCGGCTT
CCGTGAAACCTTGAACTTCGCTTGCCTACCCCGTGATCGCTACACTTACAGGAAGTATGATACGAGTACCACGGGTGATTAAGACAGGGTCATAGGTTGC
GGGGTTGAGTACTGGGTCAGGCGCTCGAGGTTGATCCATCCCATCTCTAGTTGCGGTTGAGCTTTCCATCCCAGGGGCTCCCATTTCACAATACCGATTA
CGTTTCAACGCTTTCAACGCAGTATAGCCTCGGGTGAGAAGTATATATTTAAATCCTCCGTACGTGAGGGTGGTGTGCGTGAGCTGCAGGTAACGACGCA
AAAATCTGACACAAATCCTAGATTATATCGTACCGCTGATATGTTCCGATAGTACAACAAAAAATATGTTATCCAATCACAAACTTTTATTTACACTAAT
ATTTATGCAACTCTCTGGGTTTTATATCCAGGGTTTCTCCGAGGATAGCACTCGAACCCAAATTAACTTTTATTTCTAATATGTACTAAGAACCGAAGCT
TAACTCACGTACATCATGAGAACGTTCCGATAAATCTGCCCTGATGGGTGATATTCCTCCTTAAAAATTATTTGATGGCATCTCGAATGGAAAAAATAGC
ACCGTATGATTGGTAAGGATCATTCCACAGGATCATTGTCATGAATACCCTGTGTACTTTTAAATACAGAGGTGAATGTTATCCATGGTTTGCCATCCAC
TAAAAAAAACAATTGTTACCTGCTACGTGTCCGTTTAAAACCCTGACAGCCTGTTAAACGTTTGCTAGTATGCAAATGTTGTGAATGGATTCGTGTCATG
TTTGCTGTGATACAGTGCAGAATACTCTCGGTTACATTTACTGTCCAACTATGACGACGCATATTAGTACCATCGGGACTATTCTAGTCTGTTCGACTAA
ACCGTTTGTATGTCTGGGTTGCTCCTTGCAGCACAACGAAGTAGCTGAAGCACTTATCTATACCGTAGATAA