Description :
From Genome Similarity Track
Location :
scaffold_6:141562- 142642
Sequence
1080 bases(100 bases per row)
GAATTGTCATCTGACAGAGGcattcgtcatgagattgacatacttcctggtacgaagtattgtatcacacggcagtgGCCGTTGCCAAAGAACAAGTCAT
TGCAATTGACGGGTTCTTTGTACAGCGACAGAAGGCTGGTcatgtgcgtgagagcaagtcttatCATAGTCAAAACTTGTGTATGAAGGAAGCTATAGGT
GATTGGCGCATTGtctacgctatcaacaaATTGAACGAGGTGACCTACCTGCCCAGACTCCTGTTCCACGCAAGAATATGATTCTTGATGGAACGGCTGG
CAGTACTAAGCTCAGTGCAATCGATCTGAAAGATGGTTTCTATTAGATAAGAATGTACAAAAATGATTTAGTACTAACTGCAGTTAGTAATCCGCCACAT
TCATCTCCTTTACGGAGTCGTATCGTCTGCATGAGAAGGTTGTCCTGGGTTTTTTGTGGAATTGTACAATATCCTAAATTACGATTGTACGGAAGTCGTA
AGACACGAAATTACCAAAGAAACTTTCGGTTCAGATCCTCAGTCAATCGTTCAAAGCTATTCTCTGTGCGATCGTTCGTCATATGCCTGTGGGAATACTt
agtgatgccacaaggttTAGATGACGCTCCCGCGACTTTTAACAGAGTGGTAACGAATCTTCTTCGTTCATTGAGAGAGTTTGCACCGAGTTACTTTGAC
GATGTATTTGTTCACAGTAAGAAAACGGATGAGAAGTCTGAAGCCGATGTTTATTGTTTATCTTGATCAACCTCGTCAAGTTTTCCAAGGTATGCGAGAT
AATAAACTCTACGCTCTCCAAAAAAGGTATTTTCTTTGCACCAGAGATTCCCGTTCGTGGCTGCTTTCTAGGTAAGAATGGCGTTCGTGTAGATCCGGAG
AAACCCAAGGCTATCAATGGATGGTCGGTACCAAACAATGTAGAACAGCTGAGACAGTAATTGGGTCTggccaactatttgcacaaataaaCGCGCGATT
CTGCAGCATTGGTCAATCCGGAACGACAATTAAGAAAAAAACGTTGAGTGGGATTGGCCAAATGATCATCAGGCGGTCTT