Description :
From Genome Similarity Track
Location :
Scaffold_301:14156- 34868
Transcript NameFunction/comments
Pytap_DAOMBR444maker-pag1_scaffold_301-snap-gene-0.7Regulator of chromosome condensation (RCC1)
Pytap_DAOMBR444maker-pag1_scaffold_301-snap-gene-0.8Kelch motif family protein
Pytap_DAOMBR444maker-pag1_scaffold_301-snap-gene-0.9Regulator of chromosome condensation (RCC1)
Pytap_DAOMBR444maker-pag1_scaffold_301-snap-gene-0.10Regulator of chromosome condensation (RCC1)

Sequence
20712 bases(100 bases per row)
ACGGCTGCGCGAaTGTCTGCACTGCCTCCCATCTACCTGCCTCTGTGTGAGAATGTGAAAGCGGGGGATCCCGGGACAGGCGTCTCCACGAACGACGATG
TCAAGGACGCACTGAGCAAGATCCTTGAATTCGGTCCGTCACTGCGGTTTCTTCCGAAAGGTATGGAGTTGATCTATTCATTGGGATAATGGTGAGAAGG
GAAaCGGCTCACGTCTCATTTCGATGCAGATGGGCCGAGCGCTGCTAATTCATCTGCAATTCCGCCAAATCTTGACCACCAGCTGCAAGATATATTGAGC
TCGGCAGACACAGCTAATGAATTGTTCCAGTACGTCTCAAGCTTGGCATCACTCTCTCCAGACTCTGGTACTGGTGCGCATGATGTAACTGGCAACGGGT
TTGATGGTCGCGTGGCAGCATACGTTAAATCGCTGCAGAGCTTGTACCAAACCACTAAGCGGGAGAAGCTGCGCTACGAGCAGCGCCAGCAAGCGACAAG
GTCGCAAGCCACTTCTCAGCGCAAAGTGACACCACCCCCGCTACCTCTACCAACTCAGAACTGCATGACAATGGgTTGGGAGATTGTTGTTCACCTTCTG
AAAGCGACACGGGTCGAGAACCCAGAGCAATACCTCCAAGCTCTTCACATGATCAAGGATAATCTCTTTTCGCTAAAGCCGACGACATACGCGGATAGTA
TGTATATGGCACCCTCAGCAGCTTCATCATTCAATGCACTGAGCGACTGTCTCACTGCACTGGCGAAACCGATGAATGACAAGGATGGTGTGAGCGAGGC
CAACCTCGGAGCCagAACTGTGGAAACACTTGCTGAAATAGCTCTTGCGCGAGGATCGTTGGCTAGCCTCCTTTCaGTCGTGCTATGGCTGGTCGATCAG
GCACCTGCAACTCCTGTAGATCTCGGGgTGAGtcTCTCCAAACTGTCAGCTATCAAAGAGCAACAATTaTACGGGAAGTGTGAAGCATCAGGAGAACTGT
ACTGCTGTGGTCAGAACTCCTACGGCGAGCTTGGTATCGGTGATGACATTGAAAGGCACCAACTGACAAGTGTCTCACTGTGTGGctGGGATGATATTCG
TCAAGTTGTCAGCGGCAACGAAGTATTGGCAATTCTCACGAATGGAGGCGTGGTGTTAACCTGCGGTCTCAATAAGAGTGGTCAGTGTGGTCACGGTCAT
TTCGATGAGCGAGTGATGCTTTTACGtCCAGTTCAAGCTCTTCGCTCCCAGATAATCAAGTTtGTTGCAGCAAGCAATGGATGTGAACACATGATAGCGC
TAACTGAAACTGGGCTCGCATATTCgTGGGGGTATAATGATCGtGGTCAACTCGGCCATGAGAATTTGACCACGAAGATTCACCTGCCGAAGCTGATTGA
ATCGCTCAAAGGCAAGAAAATCGGCTTCGCAGCAGTAAGCTATCACCACAGTGCTGTCATTACTGATggtggTGAGCTGTATACgTTTGGCATGAATGAC
TGTGGTCAACTTGGTCTCGATCATACCCAGCATATGGCCACTCCTCAGCACGTtAAGGCTCTCGAGGGTCAAGAGATTTCGATGGTTGCTTGCGGTCTAT
ATCATACCATCGCGTGCTCTGCAACTGGAGAGCTTTTCTCATTTGGGAAGAACGACTACGGTCAACTTGGACTGGGGCATAGTCGTCAAGTAAAGTtACC
AACACTTGTCCCTCTACCTAGTGAAATGGTTTGCTTCGTCGCGTGTGGTTACTATCATTCTGCGGTAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNCACACGTATTCCTTTGGAAGGAATGACTATGGTCAACTTGGAATCGGGTCAAAAATCCACCAGAATGTACCAACCGTTGTTGCCTTGTCCG
CAAACACACGCATGACTCGAGCCACATGCGGATGCTACCATACTGTGCTCTTATCTGAACAAGGGCAAGTGTACGTGTTTGGTCGAAACAACAAGGGTCA
GCTCGGGAATCGAAGCAGTGCTGACTCGCTGCTTCCTGTACCGCTCAAGGTTCGTCCGGAGAAGAATTCTCGTCGGTGCATCGATGTTGCAGCTGGTTTC
TATACTACTTCTCTGATCTATGAGCGCCGGAAAGAGAATGACGAAGCTGATGGGTTCGTCTTGGATCACAGTTGCTtAGTGTCTGTGTGTGGACGTGTTG
ACATCGACCGCTCTGGGGAAATTGAAGGTCTCAGTAACTTCGGCTCGGTATCTACTATCGGAATTTCATTGTTTGAGGGGAAGTGGTTCTATGAAGTCGA
GGTAGTCTCGAGTGGGCTGATTCAGATCGGTTGGATAGACAACTATTTTCAAGGAAGCTCTGATCAAGGCGAAGGTGTAGGTGATCACACTCACTCATGG
TCGTATGATGGCAATCGTCAACGGCGATGGAATAGTGGCTCATCTGCATATGGTGaaaaaTGGAAAGCAGGAGATGTAATCGGCTGCTTACTCGATTTAG
ACTCGAGTGAAATGACCTATTATCgAACGGAATCAACCTCGGGGTCGCGTTTACCGACATCAAGTGCAATCCCcATGATCCACGATCAGGTCTCATGCCC
GGAATCAGTCTCGAGCGTGGCGAGATTATTCGCGTTAATCTCGGTCACCAACCcTTCGCGTATCCACCAACTAATGTTGGAGAGTTCGATGCCATTTTCA
AGGCAATGAGCGCTCCCACATGCGGAGCATCAATAAAGTCTGTCATCGAAGAAAGACCGGACACTTGTCCTCCAATGATGGATGGCGTTGCAACagTTGC
GATCAAAAATAAGGTCTTTAGTATTGGCGGCAGTCtGTACGAAGCCGCAGACGCGgcAGCAAGTTGTCAGGTTTGGGTTTACCACTTGGATACGAAGAAA
TGGGAGCgaTGGTCTGATTTCCCAATCGGCATTCGGCACCATCAAGCAGTTGCTATTGATgaTGACACGATCTTAGTCATTGGCGGTGAGAGTAGCACAC
CTACATCCCGTCACATGGATCTCTACAAGTGTTCcGCTTCCCGTGGAGCTGACGGATCTCTCCCGGCCTGGGAGCTtGTTCAAGGTGCAATCGGAGCCGC
GAACACCCTGCCGGCTCCTCGAGCTCACCATGTTGCTGCCTCGATACGAATCCGACTCGATGGTATAATCTTCGTGTATGGGGGTAAATCAGCCGACAAC
GAGACGCTTGGAGATgTGTGGTTACTGTCACTAGAAGATTTTTCCTGGTCTCGGTTACCGAACTCAATATCTCTCGACCCTGGTCCACGAAgTGGGTGCT
CATGCGCTGTCATCGGTGAGAATGTATTTGTTTTtGGTGGTCAAGATAaGgAAGAGAAGTTCCGAGCAGATCTGTGGAGGTATAACACATTTGACCGTGT
GTGGCATTTATGTCATGATGACAATATAAATGGTGTACGAGAACACACGATCGAAGCCTCATCaCCAGAACAAacATTGAAGGCTGACTTCGcACCCATT
GTTCCTGAAGAGAGAGTCAACTACAGTTTATGTGCCGACTTTGGGAATGTTTGGTTATTTGGTGGAACTTCCTCCTCAGGATCGATCCTAAGCGATCTTT
GGTGTTATTCTGTCACAGCGCAAAAGTGGTCTTCTGTTGATGTTGGCAGTGAGGAAGAGGTGTACGGATGTTCATCAGCCTCCCTTGTTGTCCCCTTAGG
CACTCCAACTGCTCTGCCTGCATCGCTACCTGATGCAACTGTGGTCAGTACATCATCATCGAAGATGCTTCTTGTTGGTGGTTGGATGACAGgTGCAATC
GTTTCAAACACACCATCTGCTCGTGTGCGTGAGTTTGTTCCAGCGGATTCATCGCGAGCCTTTGTTGTCGACCCaGGAAAAAATATCGCAACTGCCGGGA
AGTCAGCTATTATTCTTGGTACGTTGCGCGCCAAGTGCACACCAGGAGCTAGTCGCACTAGCCAGCAGTGCGTCCCAATCGCCCTGGATTCGGCTGTTTG
TTTGCTATCTCACCTTGATCGCTTGGGAGGAGGCGATATTCCGAGCGACGATACTGATTCTATCCAGCTCTCGAGGTGTTCTTATCGATCACTTTGCGTT
GATCCGAAGCACCAGACATTCGAAGCTTTGTACCGTCTCCTCGCTAAACTATCACCAGCACTTGATCAAGGACTAGCGACTACGTGCGGTTCTGACGTTG
GAGTTGGTTCTCCACTGGTACTCAATGTCTTGTATCCTATTCTTGTGGCCATCCGCTTGTTGAAGCtAAACTTTTTtGaGGTAAAATACTATCTAAGCTT
GCGGGgTGCAATCATCTAATATCCTCTTGTCATACAGCTGACTCGAaGCAGTATCGAACCAGCTGAGGTGGGGTTGTTGCCAGCTACTAATCTGCCCGGT
GGTATGCTTTTTAtGCTACGGGAGTGCTTGTTCAAGATCGCAGAACACACTCTACCAGCTCCGTTAACCGGTGAATTATCATGGTTTTACCGAGCCGTGA
AACAGGAAACCGCAGCTACTATCTACCATGGTTTCTCAATCATGTTTCCTTCACTTCTGGATCGCGTAGAAGTGATGAACAGGTTGATGAAAGGaTCCTT
TGACAGtGACGAAACCAAGAAGCTACTTGTGCCTATGCTTGTTCCATGTTTCACATCTCCGAGAATGCTCTTTCAACTTATGGGTGAGGCAAACGCACTG
GTGTGTACATCTGAGGTTGGAGCAGAGGCTCCTGCGCTCTTGTCACAGTTTGCGACGACACTGCTTGAAGTATTGTGGGGTCAAACGAAAGAAATCATCA
AGTCATTGGGTATGGGTGAGGATCAAGTGCATGCGATTCGAAAACTGACTGAGCTCGATTCTGGGAGCGAATTCAAGTGCCTTAATGTGCTTGTTCGCGC
GAGTGTgTACTGGTGCTCGAtCTCGACAGAACGGGGATGGCCAGTCGTATTGAACATCTCAAACAAACTGGTCACTTACCTAAAtCAGCTTCTGGGGCGA
GATGGTGAACAGTTCCACCGTGATCCTGTCCGTCTTCCTCACATCCTTGAGAACACGTTTGCTGCGAAATTGTTACCGTTCATTTTGATAAGTGTCACTT
CATTACCAAGTGTTCGACTAAACTTCTCCAATCTCTTCGACACTTTTTGGCCGAACCTCCAGAGCTTACTCCTTCAAGTGCACGTGGTACTGGGTAAGTT
CGGTCCTATCGTATCGAATCGATGCGAGCCGCTCGAAgCTAACAAGACAGAGAGTGAGACGAGCTCTAACTCAACCAGATTCGCTATATCAAACGCCAAT
AGTGACACTCGCATCTCCAGTGAGCTCGCTGCTCTACTTCATTTGCCTACGTCGACAACTATTCTGTAtGACGACCTCATCCGAGCGATCTGGAAGAAAA
GTGTCTCTACTGACGGCTTTCGGCTTAGACGCGTATCTGAagCCAGTGGTGTGGCAAAGCCGGGGGAAATCCTATCATTACCATTACCAACTGATTTGGC
GAAGTTACTTGGATCGTCAGAGCTACTCGTGGTAACTACGCGTGAATTGGAGATTCCAACAGACATCTCCAGAACAAGGCAGCTTGGCCATACTTGCGTG
TCGTTTGCGCCCAGTTTCTTGATTCTTTCGCAGCATGTTCAGTTCACTGCAAAAaTGCACTCAGTAGTGTCCGTGCCAGAAAGTTGTACGCACTCTAATA
CTACCAGAAGACCGTCTGTCGCGTATGCTCCAAGTGAAACCTGCGCTGGCATTGGCTGGCTGAGAGACCTCCACAAAATGTTGATATGGATAGGTAGCCA
TTTTGCTGCTGCTCTCGTTATTGGTGAGTTGCCCGACTCAGATGGCCAACCGCTGGACCAGAGGTGGCTCCAATCGCAGCTTCTtCGAGGAGGTCTTGAT
CAAacTCAGGTGTCTGTCGgCGGCCcTCcAACCCcAaGAAaTCTCGCAGATGTTGAGAAGGACTGCCGGAATaGCGTTCTGCTCGAACAAATCGTTTCtG
GAGTTGGCGCCGGTAAACGaCTaGTCGACAAGGTGAAGAGCGCCCTGGAAGTCGGTGGATGTGTCGGCGTCGGCAGCGCCAACCCAAAaCTTATGGCAGC
TCGTCTAAAGCGTCAAGATAGTGTTGAAGCTGCTCTCGAGAAGAGTGGGAGTATTGAAGCTGTTGAAAAAGCCGTCCGTGTCGCATTTGCCGTCATTTTG
AAGCACAGTAACAAtGCATACTGCAATGGCGGGGTATCCGAAGATGGACAACCCAGTGAAGCAGTCGTGGACGCCTGGCGTTCGGCACTTCAGCTTCGAA
GATGGTATGaTtGGCTGATATGCgTtCGGAAACTTTAtCTAACGTATGATGATCCAGGATCGTTCGAGAGCAACAGAAGCTGGCGAGCGAACACAGTGCG
GCGGACAATATTTCCGATGTCTCGCTGAAGGAACGACAAATCGCGTTGTATAGCACGGTGTGCGAACCTATTATTCAACGAGGACTCCTTCTTCTTCGCG
TAGCCGCAGTTCCGTCGACGAGTAATAGCAGTTTGTCCCATCCcTtGAAACTCTTGCCAGGTATTTCAACGACAAATTTCTATGGTAAGGgTTACCGATG
GATATGTCCTTCTCGTCTTCAACGTGGTAGCTAATtAGAGGTGGGCTCCTACGTGTGACaGAAATCGCAAAgCCTATCAAGTCAGATGAAGTCAACTTAG
GGTCTCAACAGaTCCAAGACATGAGGTTAACAAAGTCGCAGGATACACTCGATGAAGAAGATGAGCGTGTCCAGGCTGATATTTTTGCCTTCCTACAACA
CAAGAGTGAAGGAAAGGGGCCTTCTTTGGACGTGAACCAACCACTAAAGGCGTTGGACCAAAGAGTTCTCGGCGAGTTgaTGGCACATGAACGAAGAGGC
CAGCAACGCTTAGCTGGACTACAAATCTTCGCTCAGTTGCTTTCATGCACATCGACGAACCCGTCTTGTAGAGTGAGCATTATCCCGGCTTTCTCCACAG
CATTCAAGCGTCTTGTGCGACGCGGGGTTCCAaTGGACGCAACGTCTGTTGTCGAGAAAGTGCATTTCTTAGAGAATCTGGAATTGGCCGGATTGGATCT
CTCACAGAAAATCCGGAATGAGtttattGcTTtACTCatCAAACTACTCGAGATTGCAACTGATCATGTACATGAGGTCCATCGACAGATTGACCGTGGA
GGATCACCGATCTCCcACACGAAAATgtCGTCATCGTGTGTTCATGAGGTCGTaCATGAAGTGATGCAAGTTTTtGAAGCCTGCAGTATTCCGTATAGCG
GAGATGATTGGATGCGAATCCAGCAAATCAAtctCTTGCCGCTCTTAACTGAGCTATCCAGCTGGCGAAGCTGGAAGGATACTTTGCGACTCGAATTCTC
AGAAGAGCACCACACCGATgTGTCAGGCCGTGGTAAATTACCAATTATCCCTGCAGGAATGGGCCATCGTTGTCCGAAAATCATCTGCCCTAGAGCTATC
ACAATTGGGACAGACCTTCACCAACTTACTTTGTCAAGCACAGATGGAGGGTTGGCCGTCTTCCACCATCCATTCTATCGTGGTAGATGGTATTGGGAGA
TTGCTGTCGTCTCTCAAGGCGATGATCCCATTTTTGTGGGTGTTGCCACGTGTGTAGATGACTTGAATGTAGGCTTCGTGGAGAACACATCCAACGGAAT
CCTCATTTTCAAAGAAACATCGGGATGTTCACTTGACGCTGCAGTAAATGCAATGCGCTGTCGTATCGGATGCACGGTCGGTGTAGTGCTCGACTGTGAT
GACAAGAAGCTAGAGTTCTTCGTTGATGAGAAACTTGCCAAAGTCATCAACTTGGATCCCAGTAAACTCTTGTCGAATGCTCTAGGCGTGTTtCCTGCGG
TCGGCATTCAAAACGCCGAAGTCTTCTGGAATCTAGTTGCGCGCGTACCAGAGAAGTTGTGGGCGTCTAGCGTCGGGTTCAGATTCTCCGCACCTGTTGT
TTCTGGTTGCCTAGTTGCAAGCCCGATTGATGGCACAACGCTGAGTCTGGATGcAAAGACTAAAGGAAAACATCTTCGACTCACACAGGACGGAACGACT
GTGATTGCTGGGGACAGTAGCTCAAGCGAGGAGCGTATGGAGGCAaTTACTGCCAACCAGAGTTTTGAGAGCGACTCTCTGTTTGCTGAGGTTCAATTGG
TATCGCCTGGACGTGGAGGAAAATGTAACCTATCTTTTtCAATCATGCCAAGTACAGATAGATGTtCCAGTTCGGGTGGTATGCCGTCCGGTGTTGATGT
GCGGTCAGTGTGGCCAGATGACGTGTCGACgTGGGGAACATTTGGGGTCCtCTTTGATTTCAGCAAAGCCAAAATAACTGTCTACCCCAATGCCGGGGCA
CCTCAAGTGCGATCACTTGATTTGAGTGCACaGAGTCGCCcACTACTACCTGTCATCAATGTGTTGTGCAACGGGgCGGTCTTTCGAGTCAATTTCCACC
CACACCATCGCCCTGAACTTCcGTCTAATGTTATTCGCCCTGTTTCAATATGCGAAAATGCGCATGTGTCAtCATCCAACGATATCCAAATTGGCAAGTT
GTTGCAGATGCAAGTCGTCAGCTGCGATGGTGGTGagTTCAGCTCTTCACACACTGCTCGAAACGCATtACAGGATGATACATTAGTATTCAGCTCAGCC
AAGGGCCGTAACGTGAACTTGATTCTTCGTCACGAGATCGATACACCATTCTGGGTGAACTATGTTACTATCCGAGGTCCAGGGCCGGgCTATTCTAGCC
CTCTTCGCCATGCTGCAATCTTtGTAACCAGCTCAGTtCCTGATTTAAGGAGGCTACAACACTACGACGACCTTACACCAGAAGAGTTTGCGTCGTTGCC
GTTCCCTGCTGCTTCCgaTTTGGAGCGACAGAGACGAATATGTACCAGTCGCGTATTGTGTATTGGATGGTAGCTGCGCTCAAGTTGCAaaacAACTAGC
TttcccaGTGCAAGggcGATACATCGTGGTGaaattgTTATGCccaGCAACAGGATCCAACATTGATttaGGNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNaccgatttgtggtgtGTaTtATtCcTTGCgTGATGATGATTCTCaGAAATTGTGTCcAACTTGCTACGACGATAATCGTGGTC
ACTTGGACGTGCCGTATTTTGCACACGTGGACGTGGATATTGATGGTCAAAACGATGATGGATTTGCATTATGCATACCTCGACGCGTCTCTGTTGAGCt
ActCTCTCGACAGCATACGTCGTCGAAAGGGCCTAGAACCGGACTGTCAGCGGTACCTagCGATCCATtAGCCATTGTCGCTGGTtcGGTGATAGCGGGA
CGGCCATcTAAACCGGATCGATCATTGGTATGGTATGAcGATTGTGAGCtGTTTTCGTGTGGACAAAACAacTATGGCGAGCTTTGCCTGGGACATTGCA
ACTCGACCAGTAAACTGGAGCATGTGCCATTTTTCAGTGCGAAGAGCGTTCGCGACATTGCTGGGGGgAACgAAGTTCTTGCTGTGTTGATGAAAGATGG
GTCACTTTTCACTTGtGGTTTAAACAAGAGTGGTCAATGCGGCAACGGAACTTTCGAGGAACGCGTCCTTGTCGCGACgCCAGTCCGCGCTCTCAACGGC
ATTCCTATCGATATGATTGCGGCTGCAAACGGATGTGAGCACATGCTCGCAGTTGCATCTGATGGCTCGGTGTACTCGTGGGGTTACAATGATCGTGGGC
AGCTGGGGCTCGGCTCAACAATTTCAAAAaGTCATACTCCTAGGTTAATCGAGTCACTCCGAGAAAAGTATGTAATTACGTCGGCGGCTGTGAGCTACCA
CCACAGTGCCGTGGTAACCAGCGCCGGTGAGTTACTGACATTTGGAATGAACGATTGTGGGCAACTTGGGCTGGACCACACCCAGCATCAGCATACACCA
CAGCTAGTGGATGCTTTATCAAGCCAGATTGTTGTCAAAGTTGCATGTGGTTTGTATCACaCCGTGATAATAACTGCTGGCGGAGAGCTGTACGCTTGTG
GCAAGAACGATTACGGGCAGCTTGGGCTCGGTCATGCTCGAAATGTCAAGCTTCCGACTCTTGTTCGGGTCGCCATTGGTGATAGTGACGAGAAGATTGT
CGACATTAGCTGTGGGTACTATCACACCGTCGCCATAACTGATAAGGGCAAACTGGTTACTTGGGGACGAAATGACTACGGACAACTCGGAATTGGAAGC
AAAGATCACAAGAATTCGCCTCAGTACGTGCCCCTTCCGTtGTCGTCGAAGATTCGAAAGTCGTCCTGTGGATGTtATCACAcgTTGATTTtACTTGCCA
ATGGACGCGTCATGGTATTTGGAAGAAACAACAAAGGACAACTCGGAGCAGGGGCGAGAACGTTACCCTCAGCAGATTTACCCTTGCCAATCCCACTGAA
TGCCTTGTCGCAAGACGAAGTCACATGCATAGCAGCTGGATTTTACAGCTCGTATATCTTGACTGGTCGGCCAAGCCAGTCACACGATGGCGATAGAAGT
AAGGATGAGCAGGCACAAGCAAAGGAAaTGGCTGAGCACAACAGTTCTGAGGcgTTATACGAGTCCTTGATGAAAGAAaTTGATCGGAATCAGtcAATTG
ATGCGATGATGCGAGTCCCACcGATCCATATCAAGCGAGGCAACATGACCAAGAAGCTGCCACTTCTAAAGCTACATGCAGCGTCATGGGCTCTCATGAG
AGCCCTTCTCTATTTGTCGCTTGAAGATCGAAGCTTTGGACgtCACCGTAGTCTAGTCTCAACGGCCACGAAGAAACCTGACGGTGTTGTCGATACGTTG
ATTGAATTTCTGCTCGAGAACTTGCGCGCACTGCAAGGCTTATCAGGACAAGGACGTGGCAGGGGATTAGAAAGCCGAGAAGTTCTGTGCGTTACGTTGA
AAAATGCGTGCGTCGGGTTACTGTCCTTGTGTGTATCACGCCCTCAGCTCGACAATATGATGTGCCGAGATGCGTCATTTCCCATCGAAGTCCTGTATCC
TCATTTCTTCCGAAATCAAGTGTtGTGGGTGCTGCTAACGTGTGGGTCTTCGAACACTGAATTGTGCTCTGTTCTTGCTTCAAATCATGATGTTGTTGCT
GAAGTCCTCAAGGGTATCGCATCATCTGACTTGTCTACTGCGACGATTTGTATTCGGCTTGCTATGCTGATTTTCCCCCtCcACTCCGTATCCCACATGA
ACAGCTCGTATCGAAACGCACAAGGTTCAATCCCCACGAACGCTtCAAGCATGGATTTGCTCACAATGCTTCTGgTTCTAaTTGGTACTCCTCTCGTTGT
TCGTCCGCGACTCTGTAATCATGAaCTAGGAATCGAGCGAGCGTGCTCGTCACTGTGCGAGTCGTCAAAATGTCTAAAGGGTTTGACATCAGCGGAGGAC
GGTAGTTGCACAGCTGTGAAAGAcGACGTTCTTGAGCAATCGCATGTTGCCAGCGCTAAAGCGTCGGAAGTCGTTGCTCTGCTCCGATATCTTACGCTCT
ATCCTGCGTGGAGAGTGGCCATCAATGCTGCAATTTCGAAGTCCTTGGATCGCGTTGATAAGCTCAGCGACATATTGGACACTGTGTGCTCGTATTACAT
CAGCATAGAAAACAAGACTGAGACaGTCGTTGTACAAGTTGAGACAGAGCAAAGCAACGACACAGCCGCAGAACAGAGTGCCGTGAGAGAGCCTGAGACG
ACGAACATTTCGCCTGAAGTCGATGACTCATCATCTCCAGACAGTGAAGCTGACACTACCAAGGACGAAGCAAGTTCCTCCAGTTCTGTGCAGGAgAAGA
AGGCGCTCCAGGTATGGCAAgAAGCAAAGGAGTCGTTGGATTCGTTGGCAGCAATTTTCGCATCGGTTAGTGTTGTTGGAGGACACGTCGAATGCATCCG
AGAAGGAGGTTTTGCTGtGgTTGACGATgcAGAGACCAAGTTTCATGGGAAATCTGGAGTTCTGTCTGGTATTAAGAAGGACACACGTGGCGATTTCGTC
GCTCGCATGCACCTTATCGAGTCGGAGGTACCATCCATATCGCCAATGTCTTCCGGTGTTTTGCCCACTGGCGATATCTCAATTAAGTGTTTGAAGGCCA
TTGAGCGAGTTCCTTCTCTGATTCACATGTTTGAGTCTGTTGATAACGTAATCGCAGCTCtATCAGTTCTCATGCTGCCACTTTCTGAAGACTCAAGTCT
CCACACTGAGTTGATGCAACCACAAAACAACTCGGTCCAAGTGATTCTTGGGCAACGAATGCGCATGTACACCAAACAGATCCAGTGGCGAGCAACAAAA
GCCCTCAGCAtGCTGCTCAGCCAAATGCCCCGACTGACTTCGGCTGTTATGAATGTCGATAGTCAGCTTCTCTCGAACGTGGCTCAAACAATTGCATCGG
AGGACGCCCTGAAGAACTCAATTGCATTTGGCAACGTCGTTGCTGATGGACGTTCAACTGGTCCAAGTGTAGTGgaTGTTCTTCATGCGCGATGGATCTG
TATCAAGCAGCGACAAGTCCTTCTTGAGACGGAAGGAATTGTAGATGACGCTCTTGATCGCTATGAAaCGTCCACACGAGAGGAGGTTGTCTCCAAACTT
GGTAAGCAGAATGCTCTGTCGTGGGGTCCcGATGCCATTCAGTCGCCACGGAAGGGTGTGACGCCACAGTTNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAGTAaGCACGAACCTGCGGgCAGAACGAAGTCGAGGTGATACGCTAAGAACACTTGgTAACCCGC
TACCTCATGGAgTgTGGGGTATCTTGCACCCGCTTCCTCAGCTCAATGAAAGTGAAAATGGCTTATCGGCATCCcAGCCTCcGCCTATTGACTACAGTCC
ATTTCACCTCACTACGCCTATCGTACGCGTGGGACGAGCTGCCGATTCATGTGATCTTATCGTGAATGATCGAAGTGTTAGCGGtcGGCACTTTCATCTT
CGCCGCGCTCGTCGTGACAaTGAAGGCGGAACAGAGGAGTTCTACGAGCTGCAAGACTTTAGtAAAAaCGGAaCGATCGTGAACGGTGcGAGAGTTCACG
GAACGAGCGTACGCGTCTCACCAGGATCGAGAATCTCCCTTATCTTATCTCgaGGAGGACTCGTCACTTACGAATTTCAAGTTCGCCAACCTCACACCTT
TGGTCACGTCGCGAATTCTACTGGCGGGCGAATGGCTCCACCTCCTATAATCACAGCGTCACAAACTGAAGGCGCAGTGCCTGTCCAAGGTCAGGAATAC
CAACAGCCATTGAGTGCTGTAGGACCAGCACCTGTTGAGCCACGTAGCCCTGCTGAAATTCAGAATCGAGGAACCCGGCCTCAGTCCATGGAAAGTCGCA
TGGATGCTTTGCGCAGTCGGATTCCTGCCGCCCAGGGCTTACGTTTGATCACGTCGATCGCTGAAAGTGAGgTCCCCCGGgCGTTGATCTCTCCAAATCC
TGCTGTCGAGTCGCCACGGGTTGGAGGTTTTGGTTCGCCGCGATCATCGATTCTTCAGGCTCCAGGAACACCAGCCGTGAGCACTCCAACGGCAAGTATG
CTCGGCAACCTTACCCCCAACGCtgTTCTTTCCCCTGCTTCATATCAACAGCGCGAAAGCTCGTCGCCCGACTCCCTACGACCGCCTGAGCCACCAAGTA
GTGAGGCTCTGAGAATTGCACTTGGTCGGGAGAGTGTATCTCGGGAAGGAAGCCACCGCACTAGCTGGagTGCGACCCCACCAGAGCCACCGCGGTTGAA
AACGTTCAGTGCGCTCAGCGATGCTTCGTCTCCACAATCGGTATACATGCTCTTTTGCCAATTATCCCGACTGCAACCCTAAATTTCtCACtCTTTTGTA
GGGATCTGCCGcTATGGAACTGATTCTTCGTCTGCGCGAAGTCGGTTTAACACAGGTTTCGCTTGAACGCTGTGAAGAGgCCATACATGTCATGAATGGT
GATGCTCACAGCGCGTTCACTATCCTGCACGAGCAGTtGTCTGCTGAACAAGTACGTGAAACCaTCTGCGTTGCAGTGCAGTGcGTCATTGTGAaGTTGT
CTGATATCTTTCGTTCATTATAATTACAGGTTCATCAGAAaGAAAgTCTTCGGTCACCAACAGTTCAGCATCTCTCAAGTCTGCTCGCTGCTTCtCCAGC
TGTGTGTGCCGAaGCTCTCAGACGAACCCAaCAAAACGTTGCAGCCGCAACCAGACTCATGCTGTCTACGGCACGGTCCGAAATTGAAGCGTGTGTTGCA
TCTTCCATGCGATCGAAAAGATCTCCGCTCGAAAGTGGATTCTGGATCGGTGATACTGACGGCGTGGAAGAAGTACcAAGCGTCACTGACTCCcTCATCA
ATTTACAAGAGATGATGGAAGAGAATCCATGCTACGCATTGACAGACTCTAGCACCGTGCAACCCCcTGCAAGATTACGACCGACTAGTCCGGTAAAGAG
CAAAACGAACACcGCCACACcAGCAGCGAAGACCCAGCTGGacTTGTGGGTCGAATGTGCAAACCATATCGATGAGGGGATTCCGGCAATGACTTCCTCA
GAGATTGATGAAGAAGAGGCCTCGTTGTGTGGCCTTTTAACCGCGGTGCATGCTCGAAAGCTTCTTCAGCAAATAGCCCGGCTCTTCAGTGATGTAAGTA
CGAATATGCAATAACTAGTAGTGGAGATCTGACCACATGATCtACGTTTTCCAGGTTCCTGAACAAGCAGACAATATGTTGGCTGCTTTCGGTGACCCTA
TCACTCTCCGCCAGCTCATTCTCTTCCcACCAGgaGAACCGAAGAGTGCGTCCCCTTGTGTGTCACAGGCGCAGACGAAACGTGACGATGACTTAAGCAC
TGGTACCATTCAGCGTGTGCTGTCTCGCACAACGCAGGAGTGCTTTGCATCTGCTCTGACAAGCACCCTAGAAGCAAACATCCGCACGAtGCAGAAAatA
TCTGCGCTCTGTCTCGACATCGAGCAAGATGGTCGCTGGTCACGTCAAGACAAGAGCGGCgTCATCCCTcACCTCcTTCGCACCTTGTTGGAGTATGAGG
CTCAAGTATTGAAGGCTGATGACTCCGGTTtGCTTCAACAGACGAATGTTGTCCACAACTTGGTAGTGGACACTTTGCTGCACACaCTATCACGAACATT
TGTCCACAACGGGTCACTTCTCAaCTGGGAaGCGGCAATGTCAAaGTCAAGACGCCCTGAAGTCATGTTTCCAAAAGGGCCTCTAAAATTGTCGTGTGGC
ATTGAATGCGTCGTTGTCACTACGTACGATCGCGTGTGGAGCGTGCCGTcACCTGATCCACTTCTGCAGTTCCGTCATAGATGGAGGAAGCGAGATATGT
CAAGCCTCCcTcGAACTGAATCTTGGCGAAcTCCGGcTTCGGATTGCTACGTCACAATCTGGCGGCCTGTAcTCCCTTCTGGAGTGACCGTTCATCAGCC
TTCGTCATGGTTTGCCATCGGTGATGTTCTTCAGACCGGTGGCGACGCGCCAGAgcGACCTGTGCTCATGATTCGTGACGACGGCTCAGGGTTGTTGGTG
CCACCAATTGGATTTGAACGCGTTGATGTGACTGGTAAGGGGCTACCTCGCAATTCGGaaaaCGATTCCGATTTGCAACGCAAACAAATTCGCTCCGTGT
GGTGGCCGACTGCTCCTCCAGGTTACGTGGCGTTTGGGTGTGTGGCAGGAAGCAAGGAAGATCCATTTCAGCCCCCGGCGGTGAATAATGTTCGTTGCAT
AAGAGAAGACCTGGTTCAGCGaGCCGAGTCGTATAAATGCATGTGGCGAGCCGAAACGCGATCATGTGGACCGCCAACGCTTCTGAAAGCTCTCGATCAG
TCCGTTTtGGATTCGCGGCGAAACCAGCCAGTTGAGAATATGAGTGTTCTTGAGCTTGCGGCAGATGAGATGCGCATCCAGACATCTCTTTGGGTCGTGG
AAGCCGACTTTAGTCGCACGATTCTACCTGTCGTCACTGTTGATAGCGCTCAAACAGATCCGATGACTGGATTCACCATCAACATGTCTCTCGAGGACAA
AATTCTCTGTGCTCCTGTGACTATTAATGATGCGATGAGTTTCATCAATACTTTGCTGCACTGCGAGGACTCCACCGCAACCACAcGtGtAGCACTTGGT
GAAGACAAGGTTtCTTCGTTttCTGTcATTCGCCCTGAGTTATCATCAGCATtGTTTGCACTCATCAAAGCGGTTCTTGCAGAGAAGCTTCCGGGTAGCG
GCCAGACCGCCGTcTCACTTgTACGGACACTCATTCGACTCATtcAACGAGGAGCTACGTGGAAGGACAAAAaCGGTCTCTTGTTCTGCCGCTCCAGGAT
CCTGACTCTCCAACAAGATAGTgacGGGGGTCTCATGATGCATTCACTTCTTCAGGCGTTTGTTGAGCTGATGCTGGTGGTCGACGAGCAGAACcGTCCC
GAGCGAGTGGCCGAGTTGACTTCGTGCATTGATAAGgAAGCCAAGTCGACCATTCATTTGCCATACCGTTtCGGTTTTGCGCGTGGAGACTCACATAAGG
AGATGCTGGTTAGCCACTCGTCGAAAATGGCGGTGACACGgCATTTTTCCGGTGAAGAGCGCAAATTTTTGTTGGAGTACCATGTTGATGAAGCTGCGAA
TGCTTCCAGTGCGACGCCAGAAACGCCCCTGGAGTGTTATTCATGCCGATTTGAACACACACCAGAGTTGGTGATGACATTGAAGAATGAGCTGAAAGCT
GAGATCGTATACTTTGAGATCACAGTTCTAGAGTGGAATAACAGCGTAGCCAGTGCaCCAGGGCTGTTTGGGTTCGGTATCTCTCCACCAGAGTTTCCCC
TGGAGGGCCCTGGGGTCGGGATGAACTCAAGTGGAGCGAACTCATACGCTTTCaCACCAGTCAGTGGCAAGGTGCATAGCTGTGATTTGAGTGCagACCA
CTGGAGGTGGAATGATCAGCTCACAGCTGTGGCGATTGGgGATGTGTATGGTTGTGGCTTGAGGATCGATACACGAGAGGTCTTCTTCACGAAGAACGGC
AGGCTACTTGGCACTGCCTTTTCATCTTTACGCAACGTACGAAACCTTCACCCCACCGTGTCAGTGAATGGTGACTGCAAGTTCTTGATAAACTTTGGAT
CGTCTGGCACAACTGGGGATGTTGTCGGTGGCAAAGTTCACTTCGCctATAGATTCAACACTATGGACTATGACAACATCATGAGTGGCTTTGAGTGGTA
TGAGCAACTGGGACAGGTATATGGCGTTTTCCAAGCGCTCATGGATCCGAGTCGCACGGaCcAAGGATCCTGTCAAAGCTCATCCACACCATCTATCTTG
CCTGATGAGTTCATGCTTTCTGCCGACAATTTCTTGTCAGAGATCTCCCAAGATGTGTGCATCCGAGTCGAGAGCTCTCATCCCTATGACTTGGAACTGC
AAGAAGCACTTGTGAACATTCCATTAGCAACCTCTATCCGTGTGAAGCTTGACGCTCAATGTGAGACAGCAAATTCACActGTCTCCAGAtCCTTCAGGG
TGGAGACTGCGCTGACAACACAACGAGTAGTAGTGAGTCAGAAGTACGGGCATTCACCGGTACATGCGgTGGGCAAGAaGTTATGATCGATGGTGACAGC
TTCGTGTGGCGGTTTCCAGTCCAGTCCAATTTCCAGTGTCGCGTTGATCGCATTCGAAAGGGACCATACCTTAAGCTCGAGAACCGCGATACTCGGCTCT
CACTGACACGCGACAAAGGCTGGCAGACGGCGATCGGAGTGGCTCGCTTTGACAGCGGGATTCACATTTGGGAAGTACGCATCACGTTTGTGACTGCTAG
CTCCAACATCTTTTTGGGGATTGCAAGACGAGATGTGCGATTGGATTCATACTTGGGTAAGGACAACCGCGGGTGGGGATGGATTGGAAATCGTGCATTG
TGGCACAACGGAAGTAAGCAGCGCGGGACGTACGGTGAGAAGTTCAAGACAGGTGACATCGTGCGGATGACCCtcGATCTGAAACGCGGCACGTTGTCCT
ATGCACTGAACGGTAAagATCTCGGCGTCGCTTTTGGTCCAGGGGgCGTTGGTCCTAAACTCGAAGGCACTTTCTACCCTGGATTTGCTCTTTACAACCA
ACGagACTCGATCGATCTCATCGCAGGACATCGCGTTGAAGACGGCGACGCTATGCTCAGTGGAGGCAGTGGCGTTAATGGCTTACTTCCTGGCGCTGTT
GGCGATGATGTGTACTACAGTGAAGATGATGAAGATGGCATGGGGGATATTGATGAAGGAATTCCTAATTTCCGTATGGAGCTTGCGACGGCACTTAGTC
AAATGGGATTCCCCATGGATTGGTGCATCTATGCCCTCCGACACTGTGAGGATGATGCTGAGCAGGCAGCCGACTTCATCTTAGCAAACATGCACGTGAT
GGAAGCCCTTGTTCGTGAAGAAACTGAGGCTCAGAGTCGAAGACTTCGCCAGCGTGAAGCTCTGGCAGCCGCAGCTGCTGCGGGTACTtCAAGTGGTGTC
CCAGCTGCACGAGGTTCTAGCCTCAACGAAGTACCGACAGCAAGCGATAcGAGTGCTGCTtGTGAcAGCCTTGACGATGTTGAAAACGCTGTTGATGGTG
CAGTGAGCTTGCCTAGTGGAGTTGACGATGGCAGTGGgACGTCAGCAGGTGAAAACACCTCTCCTCAGAACGTCGACAAGTGGGGAATAGCGTTCACGGC
TGTTCCTGAGTTTTCCGTCACTGGACGGCGATTACTGGCgTTCAAGTACGCATCCAAGCTCGAGCAGCTACACAACTCTCAGATGGTATTCACCGCCGAT
CATGACAATGCGATCGTACAAATCGTGAACGAAGTATGTGAGGCACGTGCTGAAGCGCTATTAAGCTGTGATCCGCTGCGCATGGCACCAGAAGAGTTCA
TTCCGACAGAAGAGCACTTACGCCGCTTCTCGTGCCTCAACGGTATTCCGCTCGAGCAACTGCAGAAGCGATTCTTGATACTTCGAAACTTTAACTGCCG
GCTGCAGAACTCTCTCTCGTACATCGATTTTTCTGTGAACGATGAACATTCGCTGCTGGCACGGGGTACTCGTATGCTGCGAGGCGTCATTTTTCAGAAC
GTAAAACTCGCGTGGTGGCTTAGTATCTTGAaGgAGCAGCAAAGCCcAGCAGCAGCTCGGCCTGAAATCGAAATTGATCGCCACCGTGCCCGTGAGGCGA
CCGAGATGTCAGGTCCGCGCGAGACTGTATTTGCGCAGTGCTTTGAGCAACTCCATTCTATCCAGCCATCGCTTTTACGTGGGGCTGATCGTGCGTtCAA
ATGCCAGTTTGTCGGTGAATTCGGAGACGACTTCGGTGGGTTATACCGAGAGTGTCTTGCCCAAATGAGCTCCGAGCTACAGAGCAGCGTGTTGCCTCTA
CTCAATCCATGTCCAAACGCACTTGCAGCTGTCGGAGACAACCGAGACAAGTTTGTTCCGAATGTACACCTTCGTAGTGATGCAAGGTTGGTGCAAATGG
CCGAGTTCCTCGGGAAGCTGATCGGCATAGCCATTCGCACCAAGACACCATTAGACCTGAATTTGCCAGCAATGTTCTGGAAGTCGCTTGTCGGCCAGGC
GGTCATTCGTCATGACGTCGAGTCgATCCATGAAGGATCTTTCCAGGTCGTGGAtGCAATCGATAACATCAAGGTGCATGGTATTACTGAAAGCATGTTT
GACGAGATCATTGACGCACATTTTTCGGTCATCTCAAGTGCTCGCGTGACGGTTGACATCGTCCCGGGTGGACACAACGTACGTGTTCTGTGGGAAGATA
AAGATGACTACGCTCGCGCAGTTCAGCGGTATCGCTTGAATGAGTTCATGCCATTATGCCAAGACATTATCCGCGGGATCGCGACTATACTTCCAGCGCC
GACAATTTCGCTGTTTACATGGCGGGAATTTGCAACCCTGgTGTGTGGCAAACCCACCGTGGATATTGAGCTCCTGCGACGACGCACAATCTATGGTGAT
GGTTGCCAGGCCACAGACCCTCACATTGCGTACTTCTGGGACGTcGTCAGTGAGTTCACTGATGAGCAGAAGTCATCGTTCCTGCGTTTTGTGTGGGGTC
GGTCACGGCTACCTACACATGCAGCAGATTTCACTCAGGACTTCAAGATCTCGGGACTtCCAAAGGCAGCGGGGCGCCCAGATGCGTACCTTCCGATCGC
ACACACTTGCTTTTTCTCCATCGATCTCCCCAGCTACtCTTGTCGTGAGGTGATGCGCGAGCGCCTCCTCTACGCCATCACGCACTGCTTATCAATTGAC
GCAGATAACACAACCGTCGCTCAGCGAGCTGGTCAAGGGCTCAACTGGACGGCAACGACCACTAGTGCCAGCAACACGCTCGCGGCTTCAGCATTTAGCG
CAGCAACTGCTACTGCAACCAGCACAGCAGTGGCAACAGCTGCCGCTGCTGTATCGAACGTCATAGCAGGACTATCTGCCGCGCTGGCCGAGTAGAAAGA
GCCACGACACTA