Description :
From Genome Similarity Track
Location :
Scaffold_144:14154- 15157
Transcript NameFunction/comments
Phymu_g5414hypothetical protein PHYSODRAFT_474836

Sequence
1003 bases(100 bases per row)
GCTGACCGCGAACCAGAATTCAAATATGTGGGGGTATTTGCTGCAATACAGGTATATACTTGAGCAATTCTCGAAACAGACCCCTCACGGAGATGCGCAG
AACCAAGCAATCGAGTACATGCTAGAGCAGGTGAGAACTTTGGAGAACTTTTGCACCTGTATCGGTCTGATaagtcgtacatgtacatatatACAGCTGG
GAACTCTGACTCAGCAGGATATTGCCTCGCGTTTGACCCTCAATTGCCTCTCTTGCGGCCCCGAGAGCTGGAAAATATTTCTGCCAGACGAGAAAATATC
ACTCATTGACGTAAGTGTACACAGGCACACATCTCCCTACTGTAGGCATCGGTTTTGATTTCTAATCGAAATTTCGTATTTCAGAGCTATGAAGACACCA
GTCTTCCAGCAAGTCTCAAATATCAACTTGGTTGCCGCTACCCTCGCGCCAAACAGGTACGTATGCTGTAAGAattcgtttttttttttcaccaactaac
ttcaacatcatcTCAACAACTCATTTTGACAATTTCACTTGAAAAATCTGTAGGCATTACTCAAGAATGGAGGCGACTTTCCATTCCTCTCACATCACGA
AGAGGTCACCATGCACCTCCAAGTTCATTTGCGAGCTaacggcgtcttcattgcGTGAACTTGCATCGCCCACACACGCAAAGAATAACTCGAGAAACAT
GTCTGTTATAACAAATGATGAATTTCCTACCAATCACGCGCCTTTTGCCAATCAAATTATCAACCATCGAAAATGACGGTGTGGTCAAGCTacgcagctc
ttcgcgcGGAGGTGGCACAATGGAGCGAGGACGCACTGGAAGGAGACGTCATTGTGGAGGGCCAATTAATGCACCAGCGCCGCATCAGTCGCAAATGCTC
ATTCTTCGACTTGGCCTCGGTGGCGAAGGGGTCGGATGGCAAACGGGAGCGACTTGAGGTGATCCTCAAGATCATCGACGGCGAATTgtcagaggaagaa
gtc