Description :
From Genome Similarity Track
Location :
Scaffold_713:14153- 15580
Transcript NameFunction/comments
Pytap_DAOMBR444maker-pag1_scaffold_713-fgenesh-gene-0.1Methylcrotonoyl-CoA carboxylase subunit alpha

Sequence
1427 bases(100 bases per row)
GCCGCTGTGCTCCACCAGCGCACGCTCGCCACGTCTGCGCGCAGCTTCCGCAAGATTCTGATCGCCAACCGCGGTGAGATCGCGCTGCGTGTGATCCGCT
CAGCGCAGAAGCTCGGCATTGAGACCGTGGCGGTCTATAGTGACGCCGACGCCAATGCGCAGCACGTCAAACAGGCGACGGAGGCATACCACATTGGACC
TGCGCCCGCGGCGGAGAGCTACCTCAACTATAAGAAGATCCTCGAGATCTGCAAGATCTCGGGCGCCGAGGCTGTGCATCCcGGCTACGGCTTCCTCTCG
GAGAACGCCGAATTCGCACGGGCATGTGCGGATGCCAACGTCGAGTTCATCGGCCCACCGGTGAAGGCTATCGAGGCTATGGGCTCCAAGAGCGCGTCCA
AGGACATCATGATTGCcGCGGgCGTGCCAGTCACGCCGGGATACCACGGTGAGGACCAGAGTTTcGAGACCCTGCAGGCCGAAGCGCGTAAGATTGGCTA
CCCTGTGCTGATCAAGGCCGTCCTGGGCGGAGGTGGCAAGGGTATGCGTATCGTTGATGACGAGAAaGACTTGAAGGAGTCCCTCGAGGCGTGCCAGCGC
GAGGGTAAGGCGTCGTTCGGCGATGCTCGCGTGCTGATTGAGAAGTACCTGCGAAAGCCACGCCACGTTGAGCTCCAGGTGTTCGGCGATAAGCACGGCA
ACGTCATTCACCTCTTCGAGCGTGACTGCAGTGTCCAGCGCCGCCACCAGAAGGTGCTAGAAGAAGCTCCAGCGGTAAGTGTGCAAGGACCGAGTTTGTA
ACATGTGCGCAATCTGACTTGTGTTGTATGTGATGTAGCCACACATGTCGGACGCACTGCGTAAAAaGATGGgtGATGCTGCcGTGGCTGCGgCcAaGgC
tGTGGGTTACTGTGGTGCGGGCACAGTGGAGTTCCTCTTGGATGAGGATGAATCGTTCTACTTTATGgAGATGAACACGCGTCTTCAGGTGGAGCACCCA
GTGACCGAGCTCATCaCAAAGCAGGACCTGGTCGAGCTCCAGCTGAAGGTTGCCGCTGGCCAGCAGcTCCCTATCAAGCAGGAGGACCTCAAGATTCACG
GCCACGCGATTGAGGCGCGTATCTACGCCGAGAACCCATATAAGTAAGTGTGTGCTAGCAACGCCTCGTAGCTGCTTGGTGGAGTCTGACATGCGTCTGA
AATGTTTGCTGTGCACAGCAACTTCCTCCCAGGAAGTGGTAAGCTGCAGCACTTGCGCCTGCCTCCTGTGTCGGAGAATGTGCGTGTCGACACGGGTATC
ATTGAGGGCGACGAGGTCTCCATCTTCTACGATCCTATGATTGCCAAGCTGATTGTACACGGGAAGAGCCGCGATGAGGCTCTTGACCGCCTCATCAAGG
CACTTCACCAGTATCAGATCGTAGGCC